<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE book SYSTEM "BITS-book2.dtd">
<book xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" dtd-version="2.0" xml:lang="EN">
<collection-meta collection-type="series"><title-group>
<title>U.S. Geological Survey Open-File Report</title>
<alt-title alt-title-type="pub-short-title">Open-File Report</alt-title>
<alt-title alt-title-type="pub-acronym-title">OFR</alt-title>
</title-group><contrib-group content-type="secretary-director"><contrib><string-name><given-names>DAVID</given-names><surname>BERNHARDT</surname></string-name><aff><institution>U.S. Department of the Interior</institution></aff><role>Secretary</role></contrib><contrib><string-name><given-names>James F.</given-names><surname>Reilly</surname><suffix>II</suffix></string-name><aff><institution>U.S. Geological Survey</institution></aff><role>Director</role></contrib></contrib-group><issn publication-format="print">0196-1497</issn><issn publication-format="online">2331-1258</issn></collection-meta>
<book-meta><book-id book-id-type="publisher-id">2021-1017</book-id><book-id book-id-type="doi">10.3133/ofr20211017</book-id><book-title-group>
<book-title>Distribution, Abundance, and Genomic Diversity of the Endangered Antioch Dunes Evening Primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>) Surveyed in 2019</book-title>
<alt-title alt-title-type="sentence-case">Distribution, abundance, and genomic diversity of the endangered Antioch Dunes evening-primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>) surveyed in 2019</alt-title>
<alt-title alt-title-type="running-head">Distribution, Abundance, and Genomic Diversity of the Endangered Antioch Dunes Evening Primrose Surveyed in 2019</alt-title>
</book-title-group><contrib-group content-type="collaborator">
<contrib>
<collab>Prepared in cooperation with the U.S. Fish and Wildlife Service and the Friends of San Pablo Bay National Wildlife Refuge</collab>
</contrib>
</contrib-group><contrib-group content-type="authors">
<contrib contrib-type="author"><string-name><x>Edited by</x><x> </x><given-names>Karen M.</given-names><x> </x><surname>Thorne</surname></string-name><x> and </x></contrib>
<contrib contrib-type="author"><string-name><given-names>Amy G.</given-names><x> </x><surname>Vandergast</surname></string-name></contrib>
</contrib-group><pub-date date-type="pub"><year>2021</year></pub-date><book-volume-number/><publisher>
<publisher-name>U.S. Geological Survey</publisher-name>
<publisher-loc>Reston, Virginia</publisher-loc>
</publisher><edition/><abstract>
<title>Abstract</title>
<p>Sand dune ecosystems are highly dynamic landforms found along coastlines and riverine deltas where a supply of sand-sized material is available to be delivered by aquatic and wind environments. These unique ecosystems provide habitat for a variety of endemic and rare plant and animal species. Sand dunes have been affected by human development, sand mining, and shoreline stabilization from invasive weeds. This report provides a summary of a comprehensive literature review, field survey, and genomic analysis for the Antioch Dunes evening primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii,</italic> hereafter <italic>howellii</italic>), an endemic species to the San Francisco Bay-Delta, California, which was listed as a federally endangered subspecies in 1978. <italic>Howellii</italic> is found on a historic dune sheet (the Antioch sand sheet) near the confluence of the Sacramento and San Joaquin Rivers. The Antioch sand sheet has been greatly altered by sand mining and land conversion into agriculture and urban development. In chapter A, we describe results of the literature review and field survey. We found <italic>howellii</italic> at eight locations with over 90 percent of the adult population and nearly 99 percent of juveniles observed on the Antioch Dunes National Wildlife Refuge. We measured a negative relationship between <italic>howellii</italic> numbers and invasive weed cover, illustrating the importance of mobilized open sand for this species. In chapter B, we describe the genomic study results. We surveyed genomic diversity by using double-digest restriction-site associated sequencing to estimate population genetic structure and levels of diversity across all surveyed occurrences. The genomic analyses included outgroup samples of the closely related <italic>Oenothera deltoides</italic> subsp. <italic>cognata</italic> and three occurrences of an unknown taxon with intermediate morphology to <italic>cognata</italic> and <italic>howellii</italic>, which also occurs on the Antioch sand sheet, east of the Antioch Dunes National Wildlife Refuge. These three morphologically distinctive groups formed genetically distinctive clusters and well-supported monophyletic clades in clustering and phylogenetic analyses, respectively. There was no indication of recent hybridization among any of the groups. Among <italic>howellii</italic> occurrences, the Antioch Dunes National Wildlife Refuge contained the greatest genetic diversity. Our approach, which combined field surveys, habitat assessments, and genetic analyses, can provide useful information for the conservation and management of rare and at-risk plant species and highlights the uniqueness of the Antioch sand sheet floral diversity through the discovery of a putative new taxon within the bird-cage evening primrose species complex.</p>
</abstract><custom-meta-group>
<custom-meta><meta-name>Online Only</meta-name><meta-value>True</meta-value></custom-meta>
</custom-meta-group><notes notes-type="further-information"><p>For more information on the USGS&#x2014;the Federal source for science about the Earth, its natural and living resources, natural hazards, and the environment&#x2014;visit <ext-link>https://www.usgs.gov</ext-link> or call 1&#x2013;888&#x2013;ASK&#x2013;USGS.</p></notes><notes notes-type="overview"><p>For an overview of USGS information products, including maps, imagery, and publications, visit <ext-link>https://store.usgs.gov/</ext-link>.</p></notes><notes notes-type="disclaimer"><p>Any use of trade, firm, or product names is for descriptive purposes only and does not imply endorsement by the U.S. Government.</p></notes><notes notes-type="permissions"><p>Although this information product, for the most part, is in the public domain, it also may contain copyrighted materials as noted in the text. Permission to reproduce copyrighted items must be secured from the copyright owner.</p></notes></book-meta>
<front-matter>
<front-matter-part>
<named-book-part-body>
<fig fig-type="cover"><caption><p>Cover Photo: Antioch Dunes National Wildlife Refuge sand dune habitat with Antioch Evening Primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>). Photograph taken by S. Jones, May 2019, U.S. Geological Survey.</p></caption><graphic xlink:href="ADNWR_dune.JPG"/></fig>
</named-book-part-body>
</front-matter-part>
<front-matter-part book-part-type="Conversion-Factors">
<book-part-meta>
<title-group>
<title>Conversion Factors</title>
</title-group>
</book-part-meta>
<named-book-part-body>
<table-wrap id="ta" position="float">
<caption>
<title>U.S. customary units to International System of Units</title>
</caption>
<table rules="groups">
<col width="41.88%"/>
<col width="13.69%"/>
<col width="44.43%"/>
<thead>
<tr>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Multiply</td>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">By</td>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">To obtain</td>
</tr>
</thead>
<tbody>
<tr>
<th colspan="3" valign="top" align="center" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="col">Area</th>
</tr>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">acre</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">4,047</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">square meter (m<sup>2</sup>)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">acre</td>
<td valign="top" align="left">0.4047</td>
<td valign="top" align="left">hectare (ha)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">acre</td>
<td valign="top" align="left">0.4047</td>
<td valign="top" align="left">square hectometer (hm<sup>2</sup>)</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">acre</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">0.004047</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">square kilometer (km<sup>2</sup>)</td>
</tr>
</tbody></table></table-wrap>
<table-wrap id="tb" position="float">
<caption>
<title>International System of Units to U.S. customary units</title>
</caption>
<table rules="groups">
<col width="43.81%"/>
<col width="16.25%"/>
<col width="39.94%"/>
<thead>
<tr>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Multiply</td>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">By</td>
<td valign="top" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">To obtain</td>
</tr>
</thead>
<tbody>
<tr>
<th colspan="3" valign="top" align="center" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="col">Length</th>
</tr>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">centimeter (cm)</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">0.3937</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">inch (in.)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">meter (m)</td>
<td valign="top" align="left">3.281</td>
<td valign="top" align="left">foot (ft)</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">meter (m)</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">1.094</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">yard (yd)</td>
</tr>
<tr>
<th colspan="3" valign="top" align="center" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="col">Area</th>
</tr>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">square meter (m<sup>2</sup>)</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">0.0002471</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">acre</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">square kilometer (km<sup>2</sup>)</td>
<td valign="top" align="left">247.1</td>
<td valign="top" align="left">acre</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">square meter (m<sup>2</sup>)</td>
<td valign="top" align="left">10.76</td>
<td valign="top" align="left">square foot (ft<sup>2</sup>)</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">square kilometer (km<sup>2</sup>)</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">0.3861</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">square mile (mi<sup>2</sup>)</td>
</tr>
<tr>
<th colspan="3" valign="top" align="center" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="col">Volume</th>
</tr>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">microliter (&#x03BC;L)</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">0.000033814</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">ounce, fluid (fl. oz)</td>
</tr>
<tr>
<th colspan="3" valign="top" align="center" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="col">Mass</th>
</tr>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt" scope="row">nanogram (ng)</td>
<td valign="top" align="left" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">3.527x10<sup>&#x2212;11</sup></td>
<td valign="top" align="left" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">ounce, avoirdupois (oz)</td>
</tr>
</tbody></table></table-wrap>
</named-book-part-body>
</front-matter-part>
<glossary content-type="Abbreviations">
<title>Abbreviations</title>
<def-list>
<def-item><term>ADNWR </term><def><p>Antioch Dunes National Wildlife Refuge</p></def></def-item>
<def-item><term>BDFWO</term><def><p>San Francisco Bay-Delta Fish and Wildlife</p></def></def-item>
<def-item><term>bp </term><def><p>base pair</p></def></def-item>
<def-item><term>CNDDB </term><def><p>California Natural Diversity Database</p></def></def-item>
<def-item><term>CNPS </term><def><p>California Native Plant Society</p></def></def-item>
<def-item><term>DA</term><def><p>discriminant axis</p></def></def-item>
<def-item><term>DAPC</term><def><p>discriminate analysis of principal components</p></def></def-item>
<def-item><term>ddRAD</term><def><p>double-digest restriction-site associated DNA sequencing</p></def></def-item>
<def-item><term>DNA</term><def><p>deoxyribonucleic acid</p></def></def-item>
<def-item><term>GPS</term><def><p>global positioning system</p></def></def-item>
<def-item><term>NDVI </term><def><p>normalized difference vegetation index</p></def></def-item>
<def-item><term>NWR </term><def><p>National Wildlife Refuge</p></def></def-item>
<def-item><term>PC</term><def><p>principal component</p></def></def-item>
<def-item><term>PCA</term><def><p>principal component analysis</p></def></def-item>
<def-item><term>PCR</term><def><p>polymerase chain reaction</p></def></def-item>
<def-item><term>RTK</term><def><p>Leica Real-Time Kinematic</p></def></def-item>
<def-item><term>SNP</term><def><p>single nucleotide polymorphism</p></def></def-item>
<def-item><term>SSURGO </term><def><p>soil survey geographic database</p></def></def-item>
<def-item><term>USFWS </term><def><p>U.S. Fish and Wildlife Service</p></def></def-item>
<def-item><term>USGS </term><def><p>U.S. Geological Survey</p></def></def-item>
<def-item><term>VCF</term><def><p>variant call format</p></def></def-item>
</def-list>
</glossary>
</front-matter>
<book-body>
<book-part>
<book-part-meta>
<title-group>
<title>Chapter A. Distribution and Abundance of the Endangered Antioch Dunes Evening-Primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>)</title>
</title-group>
<contrib-group content-type="chapter-authors">
<contrib contrib-type="author"><string-name><x>By</x><x> </x><given-names>Scott F.</given-names><x> </x><surname>Jones</surname></string-name><x>, </x></contrib>
<contrib contrib-type="author"><string-name><given-names>Anna</given-names><x> </x><surname>Kennedy</surname></string-name><x>, </x></contrib>
<contrib contrib-type="author"><string-name><given-names>Chase M.</given-names><x> </x><surname>Freeman</surname></string-name><x>, and </x></contrib>
<contrib contrib-type="author"><string-name><given-names>Karen M.</given-names><x> </x><surname>Thorne</surname></string-name></contrib>
</contrib-group>
</book-part-meta>
<body>
<sec>
<title>Executive Summary</title>
<list id="L1" list-type="bullet">
<list-item><label>&#x2022;</label><p>The Antioch Dunes evening primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii,</italic> hereafter <italic>howellii</italic>) was listed as a federally endangered subspecies in 1978. A comprehensive literature review was completed to determine the documented historical and current range of <italic>howellii</italic> and to identify characteristics of suitable habitat.</p></list-item>
<list-item><label>&#x2022;</label><p>Of the 16 sites identified from the literature, 8 were selected for field surveys: Antioch Dunes National Wildlife Refuge (Stamm and Sardis Units), Brannan Island, Browns Island, Dutch Slough, City of Oakley Parcel (Legless Lizard Preserve), Georgia-Pacific Corporation property, and Kemwater/Olin Corporation property.</p></list-item>
<list-item><label>&#x2022;</label><p><italic>Howellii</italic> was present at all surveyed sites except Dutch Slough and Kemwater/Olin property. The majority of <italic>howellii</italic> are found on the Antioch Dunes National Wildlife Refuge, with smaller populations persisting at Brannan Island, Browns Island, and the Regional Parks Botanic Garden, where outplantings were done in the 1970s. A naturally occurring population also exists on the City of Oakley Parcel.</p></list-item>
<list-item><label>&#x2022;</label><p>A total of 5,436 adult and 49,125 juvenile individuals were counted (96 percent of adults and nearly 100 percent of juveniles were found in the constructed dune restoration on the Stamm Unit in Management Area 1). Off-refuge populations contained only 1 percent of adults and 0.1 percent of juveniles.</p></list-item>
<list-item><label>&#x2022;</label><p>Decreasing total community plant cover was correlated with exponentially increasing <italic>howellii</italic> populations and altered <italic>howellii</italic> plant demography. Above 75-percent plant cover, which represents habitat invaded by non-native annual grasses, there were more adults than juveniles in a population, which may hamper long-term population viability.</p></list-item>
<list-item><label>&#x2022;</label><p>Sandy dune habitat, where large <italic>howellii</italic> populations exist, had a distinct (&lt;0.1) normalized difference vegetation index score, which could allow additional habitat to be identified by using satellite or aerial imagery and ancillary landscape variables.</p></list-item></list>
</sec>
<sec>
<title>Introduction</title>
<p>The Antioch Dunes National Wildlife Refuge (ADNWR) was established in 1980 to protect and provide critical habitat for three federally endangered species: Lange&#x2019;s metalmark butterfly (<italic>Apodemia mormo langei</italic>), Antioch Dunes evening primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>, hereafter <italic>howellii</italic>), and Contra Costa wallflower (<italic>Erysimum capitatum</italic> var. <italic>angustatum</italic>; <xref ref-type="bibr" rid="r-1-20">U.S. Fish and Wildlife Service, 1984</xref>). Although most of <italic>howellii</italic> exist at ADNWR, small populations were outplanted at Brannan Island, Browns Island, Point Reyes National Seashore, and the Regional Parks Botanic Garden (formerly Tilden Botanic Garden) in the 1970s in an effort to prevent the species&#x2019; extinction (<xref ref-type="bibr" rid="r-1-22">U.S. Fish and Wildlife Service, 2008</xref>).</p>
<p>The Antioch region contained an extensive sand dune system formed from the combination of wind-blown and riverine sedimentary processes acting over cycles of interglacial and glacial periods (<xref ref-type="bibr" rid="r-1-1">Atwater, 1982</xref>; <xref ref-type="bibr" rid="r-1-15">Powell, 1983</xref>). This dune system, the Antioch sand sheet, extended about 2 miles along the south bank of the San Joaquin River to the east of Antioch, and reached heights of 115 feet (<xref ref-type="bibr" rid="r-1-21">U.S. Fish and Wildlife Service, 2002</xref>). Human alteration of the region, including conversion to dairy farms, vineyards, and a brick factory, dates back to the mid to late 1800s; in the 1900s, large scale sand mining and other industrial uses occurred (<xref ref-type="bibr" rid="r-1-21">U.S. Fish and Wildlife Service, 2002</xref>). Sand mining and other impacts reduced dune heights to around 50 feet in elevation, at the highest. Today, most of the remaining dunes exist within the ADNWR boundary (<xref ref-type="bibr" rid="r-1-21">U.S. Fish and Wildlife Service, 2002</xref>).</p>
<p><italic>Howellii</italic> is a short-lived perennial that flowers between March and September and peaks in May (<xref ref-type="bibr" rid="r-1-22">U.S. Fish and Wildlife Service, 2008</xref>). The modern distribution of <italic>howellii</italic> is on sandy soils associated with riverine dunes (<xref ref-type="bibr" rid="r-1-22">U.S. Fish and Wildlife Service, 2008</xref>); the historical distribution on the broader Antioch sand sheet is unclear. Invasive, non-native vegetation encroachment into dune habitat is the leading threat to <italic>howellii</italic>, stabilizing dune systems, suppressing seedling recruitment, and limiting population growth (<xref ref-type="bibr" rid="r-1-21">U.S. Fish and Wildlife Service, 2002</xref>; <xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>). Invasive vegetation also could inhibit germination of the substantial seedbank (<xref ref-type="bibr" rid="r-1-14">Pavlik and others, 1993</xref>; <xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>). Removal of invasive vegetation from the substrate surrounding mature <italic>howellii</italic> individuals enhances seed germination rates and survival (<xref ref-type="bibr" rid="r-1-9">Greene, 1995</xref>; <xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>). The impact of invasion may be substrate dependent, with insect herbivory affecting seedlings on dune sands and moisture or nutrient availability playing a role on clay soils (<xref ref-type="bibr" rid="r-1-13">Pavlik and Manning, 1993</xref>).</p>
<sec>
<title>Goals and Objectives</title>
<p>The U.S. Fish and Wildlife Service (USFWS) San Francisco Bay-Delta Fish and Wildlife Office (BDFWO) has completed or is in the process of developing recovery criteria, a species status assessment, and 5-year review for <italic>howellii</italic>. To inform these efforts, the overall goals of this chapter were to conduct a thorough survey of current and historical locations for the Antioch Dunes evening-primrose across the known range and explore the relationship of environmental variables to Antioch Dunes evening-primrose abundance and distribution. Specifically, we perform the following steps:</p>
<list id="L2" list-type="bullet">
<list-item><label>&#x2022;</label><p>Document the historical extent of <italic>howellii</italic> using a literature review,</p></list-item>
<list-item><label>&#x2022;</label><p>Quantify modern <italic>howellii</italic> population presence/absence and demography, and</p></list-item>
<list-item><label>&#x2022;</label><p>Determine habitat characteristics that indicate current and possible <italic>howellii</italic> population presence and demography.</p></list-item></list>
</sec>
</sec>
<sec>
<title>Methods</title>
<sec>
<title>Literature Review</title>
<p>A comprehensive literature review of peer-reviewed papers, news articles, vegetation databases, USFWS grey literature and internal documents, and herbaria collections was completed to document the historical and current range of <italic>howellii</italic> and to determine field survey sites. For web search engines, combinations of keywords &#x201C;Antioch Dunes evening primrose,&#x201D; &#x201C;<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>,&#x201D; &#x201C;Antioch Dunes,&#x201D; and &#x201C;range&#x201D; were used. Vegetation databases included CalFlora, USFWS Environmental Conservation Online System (ECOS), California Native Plant Society (CNPS) internal databases, and citizen-science platform iNaturalist. The USFWS provided a query of the California Department of Fish and Wildlife&#x2019;s California Natural Diversity Database (CNDDB).</p>
<p>We also searched herbaria databases that contain location information, including the Consortium of California Herbaria One (CCH1), The University and Jepson Herbaria of the University of California at Berkeley, and the BIO Herbarium at the University of Guelph (OAC-BIO Herbarium). An in-person visit was made to the UC Davis Center for Plant Diversity Herbarium to view specimens. The UC Davis Library Map Collection database was queried to look for any relevant soil or land use maps that might give an indication of where suitable habitat may have existed historically. The USFWS BDFWO provided documents including reports from past <italic>howellii</italic> surveys, summary spreadsheets of management actions, and CNDDB exports.</p>
</sec>
<sec>
<title>Site Descriptions</title>
<p>All study sites determined from the literature review are in the Bay-Delta region of California, near the confluence of the Sacramento and San Joaquin Rivers (<xref ref-type="fig" rid="figA.1">fig. A1</xref>). Sites were historically part of a 6,700-acre dune sheet (<xref ref-type="bibr" rid="r-1-11">McNally, 2014</xref>). Although soil dating work has shown multiple deposits of sand over time, most sand is thought to have been deposited during the most recent glaciation period (12,000&#x2013;26,000 years ago; <xref ref-type="bibr" rid="r-1-1">Atwater, 1982</xref>; <xref ref-type="bibr" rid="r-1-15">Powell, 1983</xref>). Today, only remnants of this system remain because of climate and land use changes (<xref ref-type="bibr" rid="r-1-15">Powell, 1983</xref>).</p>
<fig id="figA.1" position="float" fig-type="figure"><label>Figure A1</label><caption><p>Site map of all locations surveyed for <italic>howellii</italic> in May and June 2019.</p><p content-type="toc">A1. Site map showing all locations surveyed for <italic>howellii</italic> in May and June 2019</p></caption>
<long-desc>A1. Color-shaded site map of all locations surveyed for howellii in May and June 2019</long-desc><graphic xlink:href="sac21-4141_figA.1"/></fig>
<p>We visited eight sites where <italic>howellii</italic> was known or thought to be present (<xref ref-type="fig" rid="figA.1">fig. A1</xref>): Antioch Dunes National Wildlife Refuge (ADNWR, Stamm and Sardis Units considered separately), Brannan Island State Recreation Area, Browns Island, City of Oakley Parcel (Legless Lizard Preserve), Dutch Slough vineyard, Georgia-Pacific Corporation property in Antioch, and Kemwater/Olin Corporation property in Antioch. Additionally, population estimates from the East Bay Regional Parks Botanic Garden in Berkeley were obtained. Within the ADNWR Stamm unit, a recent constructed dune restoration site (Stamm Management Area 1) was considered separately from the off-dune habitat within that unit. This constructed dune restoration consisted of open sand features constructed from the placement of sand dredge material onto ADNWR Stamm unit property.</p>
</sec>
<sec>
<title><italic>Howellii</italic> Distribution and Abundance</title>
<p>Field surveys were done during peak bloom in May and June 2019 to determine the presence or absence of <italic>howellii</italic> and to count adult (buds, flowers, or fruit present) and juvenile (no sexual organs present) individuals. All sites were visited before surveying to determine if plants were present and the intensity of sampling necessary to count each individual. At sites where <italic>howellii</italic> populations were detected during site visits, field surveys were done using a grid system loaded on a Leica Real-Time Kinematic Global Positioning System (RTK GPS; &#x00B1;1 centimeter [cm] horizontal, &#x00B1;2 cm vertical accuracy; Leica Geosystems Inc., Norcross, Georgia). At Brannan Island, Browns Island, and the City of Oakley Parcel, grid dimensions were 16 meters (m) by 16 m. At ADNWR, we used a pre-existing 20- by 20-m grid established during 2017 vegetation inventory surveys (Mathers and U.S. Fish and Wildlife Service, 2018). Surveyors walked transects through each grid counting the number of individuals, if present. A GPS point was taken at each individual plant to record location data and ensure that there was no double-counting. Where plants were clustered together (within 1 square meter [m<sup>2</sup>]), several individuals were recorded under one RTK point. On the constructed dune system, in the Stamm Management Area 1 of ADNWR RTK, surveys were not practical because of the high density of plants; RTK points were therefore only taken at individuals where leaves were collected for genetic analysis. All other individuals on the constructed dune were counted at the grid scale. To accomplish counts at the grid scale, flags were laid out at the corners of each grid using RTK, and all individuals were estimated in groups of 10s or, rarely, 100s.</p>
<p>Additionally, representative photographs were taken of <italic>howellii</italic> at all sites where plants were located. These individual photographs were taken to document any morphological differences between <italic>howellii</italic> populations and as a record of occurrence. All count data were summarized as total populations within sites, and density of adult and juveniles (number of individuals in a grid/total grid area) to allow comparison between ADNWR and other sites. The ratio of juvenile to adult individuals was calculated for each grid by dividing the density of juveniles by the density of adults; ratios above 1 indicate higher density of juveniles than adults whereas ratios below 1 indicate higher density of adults than juveniles.</p>
</sec>
<sec>
<title><italic>Howellii</italic> Spatial Ecology</title>
<p>For each sampling grid, a visual estimate of the total percent cover of the plant community was recorded. This estimate included all plants and is a proxy for how invaded the sandy substrate was by invasive annual grasses. Notes about the dominant plant community were recorded as well, and any specific features that could influence <italic>howellii</italic> (in other words, road or ant mound in grid) were recorded when present. The relationship between <italic>howellii</italic> density and total plant cover was quantified by using linear regression in R v3.6 (<xref ref-type="bibr" rid="r-1-16">R Core Team, 2016</xref>); density was log-transformed to meet assumptions of homoscedasticity.</p>
<p>Soil type and normalized difference vegetation index (NDVI) were assessed to determine relationships to current <italic>howellii</italic> populations. In addition, these layers were used to locate potential habitat across the historical Antioch sand sheet. Historical land cover (<xref ref-type="bibr" rid="r-1-18">Stanford and others, 2011</xref>) and soil type (Soil Survey Geographic Database [SSURGO], accessed in 2019, <ext-link ext-link-type="uri" xlink:href="https://websoilsurvey.nrcs.usda.gov/">https://websoilsurvey.nrcs.usda.gov/</ext-link>) describe the historical spatial cover of the sand sheet. Modern land cover was then used to estimate remaining land that might support populations of <italic>howellii</italic>. The 2018 4-band National Agriculture Imagery Program (NAIP) imagery data layer was used to create the NDVI layer. Mean NDVI was calculated within each sampling grid in ArcGIS (Environmental Systems Research Institute [ESRI], 2011, ArcGIS Desktop: Release 10. Redlands, California) and extracted to the <italic>howellii</italic> grid data. The relationship between <italic>howellii</italic> density and NDVI was quantified using segmented regression in R to determine the NDVI breaks where <italic>howellii</italic> occurred.</p>
</sec>
</sec>
<sec>
<title>Results</title>
<sec>
<title>Literature Review</title>
<p>The literature review identified 16 sites to investigate as potential <italic>howellii</italic> populations. These sites historically contained <italic>howellii</italic> or were mentioned in internal USFWS documents, peer-reviewed literature, CNPS location records, or herbaria records (<xref ref-type="table" rid="tA.1">table A1</xref>). Of these sites, eight were visited to quantify total population size and demography of individuals (<xref ref-type="table" rid="tA.1">table A1</xref>). A summary of the literature review is provided in appendix A1.</p>
<table-wrap id="tA.1" position="float">
<label>Table A1</label><caption><title>Existing and historical <italic>howellii</italic> populations and associated metadata.</title>
<p content-type="toc">A1. Existing and historical <italic>howellii</italic> populations and associated metadata</p>
<p>[USGS, U.S. Geological Survey; USFWS, U.S. Fish and Wildlife Service; NA, not applicable; CA, California; Dept, department; ADNWR, Antioch Dunes National Wildlife Refuge; ~, approximately; &lt;, less than]</p>
</caption>
<table rules="groups">
<col width="16.29%"/>
<col width="15.09%"/>
<col width="14.97%"/>
<col width="19.74%"/>
<col width="10.85%"/>
<col width="11.06%"/>
<col width="12%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Site</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Location</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Ownership</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Notes on occurrence</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Date of last survey</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Population size at last survey</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">USGS action</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">Antioch Dunes National Wildlife Refuge (Sardis Unit and Stamm Management Areas 2&#x2013;4)</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">38.015904, &#x2013;121.795575</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">USFWS</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">Naturally occurring population<sup>1</sup>.</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">2017</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt"><sup>10</sup>2,334</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Antioch Dunes National Wildlife Refuge &#x2013; Stamm Management Area 1</td>
<td valign="top" align="left">38.016492, &#x2013;121.799392</td>
<td valign="top" align="center">USFWS</td>
<td valign="top" align="left">Naturally occurring population<sup>1</sup>.</td>
<td valign="top" align="center">2018</td>
<td valign="top" align="char" char="."><sup>13</sup>2,930</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Antioch Sand Hills</td>
<td valign="top" align="left">Lat/long not recorded.</td>
<td valign="top" align="center">Unknown</td>
<td valign="top" align="left">Herbarium specimens &#x2013; descriptions reference the Antioch area<sup>11,12</sup>.</td>
<td valign="top" align="center">NA</td>
<td valign="top" align="center">NA</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Brannan Island</td>
<td valign="top" align="left">38.116672, &#x2013;121.684378</td>
<td valign="top" align="left">CA Dept of Parks and Recreation</td>
<td valign="top" align="left"><sup>2</sup>Outplanting from ADNWR in ~1970.</td>
<td valign="top" align="center">2012</td>
<td valign="top" align="char" char="~"><sup>1</sup>~50</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Browns Island</td>
<td valign="top" align="left">38.033497, &#x2013;121.869026</td>
<td valign="top" align="left">East Bay Regional Parks District (EBRPD)</td>
<td valign="top" align="left">Outplanting from ADNWR in 1978. EBRPD provided location data.<sup>1</sup></td>
<td valign="top" align="center">2018</td>
<td valign="top" align="char" char="."><sup>1</sup>34</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">City of Antioch Vacant Lot</td>
<td valign="top" align="left">38.012952, &#x2013;121.766900</td>
<td valign="top" align="left">City of Antioch</td>
<td valign="top" align="left">Under eucalyptus east end of property. Currently vehicle lot.</td>
<td valign="top" align="center">1992</td>
<td valign="top" align="char" char="."><sup>4</sup>24</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">City of Oakley Parcel</td>
<td valign="top" align="left">38.003748, &#x2013;121.729023</td>
<td valign="top" align="left">City of Oakley</td>
<td valign="top" align="left">Presumed to be naturally occurring population.</td>
<td valign="top" align="center">1998</td>
<td valign="top" align="char" char="."><sup>4</sup>30</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Dutch Slough</td>
<td valign="top" align="left">38.005293, &#x2013;121.689301</td>
<td valign="top" align="left">CA Dept of Water Resources</td>
<td valign="top" align="left">Tentative ID of one <italic>howellii</italic> by P. Baye in 2003. Believed to have both subspecies <italic>cognata</italic> and <italic>howellii</italic><sup>6</sup>.</td>
<td valign="top" align="center">Unknown</td>
<td valign="top" align="center">Unknown</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Georgia-Pacific Corporation</td>
<td valign="top" align="left">38.014694, &#x2013;121.785833</td>
<td valign="top" align="left">Georgia-Pacific Corporation</td>
<td valign="top" align="left">Naturally occurring population<sup>1</sup>.</td>
<td valign="top" align="center">2017</td>
<td valign="top" align="center"><sup>14</sup>0</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Kemwater/Olin Corporation</td>
<td valign="top" align="left">38.013603, &#x2013;121.780598</td>
<td valign="top" align="left">Private property</td>
<td valign="top" align="left">On/down slope abutting USFWS Sardis Unit<sup>10</sup>.</td>
<td valign="top" align="center">2007</td>
<td valign="top" align="char" char="&lt;"><sup>1</sup>&lt;50</td>
<td valign="top" align="left">Resurvey site</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Lime Ridge Open Space</td>
<td valign="top" align="left">37.945896, &#x2013;121.989560 (estimated)</td>
<td valign="top" align="left">City of Walnut Creek</td>
<td valign="top" align="left"><italic>Howellii</italic> and <italic>cognata</italic> reportedly observed by B. Pavlik<sup>6</sup>. Abandoned sand quarry contained potential hybrids<sup>7.8</sup>. Site developed<sup>9</sup>.</td>
<td valign="top" align="center">Late 1990s</td>
<td valign="top" align="center">Unknown</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Point Reyes National Seashore</td>
<td valign="top" align="left">Unknown</td>
<td valign="top" align="left">U.S. National Park Service</td>
<td valign="top" align="left">Outplanting done in 1970s&#x2014;failed<sup>1</sup>.</td>
<td valign="top" align="center">Unknown</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Private property in Oakley</td>
<td valign="top" align="left">Unknown</td>
<td valign="top" align="left">Private property</td>
<td valign="top" align="left">Specific location undeterminable<sup>4</sup>. Presumed</td>
<td valign="top" align="center">1978</td>
<td valign="top" align="char" char="."><sup>4</sup>1</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Rancho Santa Ana Botanic Garden</td>
<td valign="top" align="left">34.110550, &#x2013;117.714771</td>
<td valign="top" align="left">Rancho Santa Ana Botanic Garden</td>
<td valign="top" align="left">Cultivated in botanic garden<sup>9</sup>.</td>
<td valign="top" align="center">2014</td>
<td valign="top" align="char" char="."><sup>9</sup>2</td>
<td valign="top" align="left">No further action</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Regional Parks Botanic Garden</td>
<td valign="top" align="left">37.892893, &#x2013;122.242802</td>
<td valign="top" align="left">East Bay Regional Parks District</td>
<td valign="top" align="left"><sup>1</sup>Outplanting done in 1970.</td>
<td valign="top" align="center">2014</td>
<td valign="top" align="char" char="."><sup>9</sup>21</td>
<td valign="top" align="left">Population estimate</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">San Francisco Botanical Garden at Strybing Arboretum</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">37.767724, &#x2013;122.469312</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">San Francisco Botanical Garden</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">Cultivated in botanic garden. No plants in collection at present<sup>15</sup>.</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">2014</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt"><sup>15</sup>3</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">No further action</td>
</tr>
</tbody></table>
<table-wrap-foot>
<fn id="tA.1n1"><label><sup>1</sup></label><p>U.S. Fish and Wildlife Service, 2008.</p></fn>
<fn id="tA.1n2"><label><sup>2</sup></label><p>U.S. Fish and Wildlife Service, 1984.</p></fn>
<fn id="tA.1n3"><label><sup>3</sup></label><p>M. Hammond, East Bay Regional Parks District, personal communication, 2019.</p></fn>
<fn id="tA.1n4"><label><sup>4</sup></label><p>East Bay chapter of the California Native Plant Society, 2019.</p></fn>
<fn id="tA.1n5"><label><sup>5</sup></label><p>Beamish and others, 2004.</p></fn>
<fn id="tA.1n6"><label><sup>6</sup></label><p>Wong and Kolar, 2002.</p></fn>
<fn id="tA.1n7"><label><sup>7</sup></label><p>California Department of Fish and Wildlife, 2018.</p></fn>
<fn id="tA.1n8"><label><sup>8</sup></label><p>A. Janke, Walnut Creek Open Space, personal communication, 2019.</p></fn>
<fn id="tA.1n9"><label><sup>9</sup></label><p>Center for Plant Conservation, 2014.</p></fn>
<fn id="tA.1n10"><label><sup>10</sup></label><p>U.S. Fish and Wildlife Service, 2019.</p></fn>
<fn id="tA.1n11"><label><sup>11</sup></label><p>California Consortium of Herbaria, 2019.</p></fn>
<fn id="tA.1n12"><label><sup>12</sup></label><p>Ontario Agricultural College BIO Herbatium, 2019.</p></fn>
<fn id="tA.1n13"><label><sup>13</sup></label><p>U.S. Fish and Wildlife Service, 2018.</p></fn>
<fn id="tA.1n14"><label><sup>14</sup></label><p>U.S. Fish and Wildlife Service, 2017.</p></fn>
<fn id="tA.1n15"><label><sup>15</sup></label><p>V. Stewart, San Francisco Botanical Garden, personal communication, 2019.</p></fn></table-wrap-foot>
</table-wrap>
</sec>
<sec>
<title><italic>Howellii</italic> Distribution and Abundance</title>
<p>We confirmed the presence of <italic>howellii</italic> at six of the eight sites we visited (<xref ref-type="fig" rid="figA.2">figs. A2</xref>&#x2013;5; <xref ref-type="table" rid="tA.2">table A2</xref>). In addition, Regional Parks Botanic Garden provided individual counts. A total of 54,216 plants were counted, 5,220 of which were adults (<xref ref-type="table" rid="tA.2">table A2</xref>). More than 98 percent of individual <italic>howellii</italic> were found within ADNWR, with the constructed dune restoration at Stamm Management Area 1 accounting for 96 percent of adult individuals and nearly 100 percent of juvenile individuals at the time of surveying. A shapefile of individual GPS points for ADNWR Sardis Unit, ADNWR Stamm Unit outside of the constructed dune in Management Area 1, Brannan Island, Browns Island, Georgia-Pacific Corporation, and the City of Oakley Parcel are available as appendix A2.</p>
<fig id="figA.2" position="float" fig-type="figure"><label>Figure A2</label><caption><p>Representative site images from surveyed locations where <italic>howellii</italic> was found. <italic>A</italic>, Antioch Dunes National Wildlife Refuge (ADNWR) Stamm Management Area 1 on the constructed dune restoration; <italic>B</italic>, ADNWR Stamm Unit outside of Management Area 1 constructed dune (representative of Sardis Unit as well); <italic>C</italic>, Brannan Island; <italic>D</italic>, Browns Island; <italic>E</italic>, City of Oakley Parcel; and <italic>F</italic>, Georgia-Pacific Corporation. Photographs taken by Scott F. Jones, U.S. Geological Survey, May 2019.</p><p content-type="toc">A2. Photographs showing representative site images from surveyed locations where <italic>howellii</italic> was found</p></caption>
<long-desc>A2. Surveyed land where howellii was found</long-desc><graphic xlink:href="sac21-4141_figA.2"/></fig>
<fig id="figA.3" position="float" fig-type="figure"><label>Figure A3</label><caption><p>Individual <italic>howellii</italic> observed outside of the constructed dune restoration within Antioch Dunes National Wildlife Refuge (ADNWR) Stamm Management Area 1.</p><p content-type="toc">A3. Graph showing individual <italic>howellii</italic> observed outside of the constructed dune restoration within Antioch Dunes National Wildlife Refuge Stamm Management Area 1</p></caption>
<long-desc>A3. Individual howellii observed outside of the constructed dune restoration within Antioch Dunes National Wildlife Refuge Stamm Management Area 1</long-desc><graphic xlink:href="sac21-4141_figA.3"/></fig>
<fig id="figA.4" position="float" fig-type="figure"><label>Figure A4</label><caption><p>Count of <italic>howellii</italic> individuals within Antioch Dunes National Wildlife Refuge (ADNWR) Stamm and Sardis Units.</p><p content-type="toc">A4. Images showing count of <italic>howellii</italic> individuals within Antioch Dunes National Wildlife Refuge Stamm and Sardis Units</p></caption>
<long-desc>A4. Count of howellii individuals within Antioch Dunes National Wildlife Refuge Stamm and Sardis Units</long-desc><graphic xlink:href="sac21-4141_figA.4"/></fig>
<fig id="figA.5" position="float" fig-type="figure"><label>Figure A5</label><caption><p>Density of <italic>howellii</italic> individuals at surveyed sites across the region.</p><p content-type="toc">A5. Images showing density of <italic>howellii</italic> individuals at surveyed sites across the region</p></caption>
<long-desc>A5. Density of howellii individuals at surveyed sites across the region</long-desc><graphic xlink:href="sac21-4141_figA.5"/></fig>
<table-wrap id="tA.2" position="float">
<label>Table A2</label><caption><title>Site summaries of <italic>howellii</italic> individual counts for all known populations from 2019 surveys.</title>
<p content-type="toc">A2. Site summaries of <italic>howellii</italic> individual counts for all known populations from 2019 surveys</p>
<p>[ADNWR, Antioch Dunes National Wildlife Refuge]</p>
</caption>
<table rules="groups">
<col width="54.6%"/>
<col width="14.67%"/>
<col width="16.24%"/>
<col width="14.49%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Site</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Adult individuals</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Juvenile individuals</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Total individuals</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">ADNWR&#x2014;constructed dune within Stamm Management Area 1</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">5,220</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">48,996</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">54,216</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">ADNWR&#x2014;Stamm Unit excluding constructed dune within Management Area 1</td>
<td valign="top" align="char" char=".">103</td>
<td valign="top" align="char" char=".">21</td>
<td valign="top" align="char" char=".">124</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">ADNWR&#x2014;Sardis Unit</td>
<td valign="top" align="char" char=".">42</td>
<td valign="top" align="char" char=".">54</td>
<td valign="top" align="char" char=".">96</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Browns Island</td>
<td valign="top" align="char" char=".">37</td>
<td valign="top" align="char" char=".">17</td>
<td valign="top" align="char" char=".">54</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Brannan Island</td>
<td valign="top" align="char" char=".">27</td>
<td valign="top" align="char" char=".">6</td>
<td valign="top" align="char" char=".">33</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">City of Oakley Parcel</td>
<td valign="top" align="char" char=".">4</td>
<td valign="top" align="char" char=".">28</td>
<td valign="top" align="char" char=".">32</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Regional Parks Botanic Garden</td>
<td valign="top" align="char" char=".">2</td>
<td valign="top" align="char" char=".">3</td>
<td valign="top" align="char" char=".">5</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Georgia-Pacific Corporation</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Dutch Slough</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">Kemwater/Olin Corporation</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">0</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">0</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">0</td>
</tr>
</tbody></table></table-wrap>
</sec>
<sec>
<title><italic>Howellii</italic> Spatial Ecology</title>
<p>Populations across sites were not randomly distributed; decreasing total plant cover increased total <italic>howellii</italic> population numbers exponentially across all sites (<xref ref-type="fig" rid="figA.6">fig. A6</xref>). Increased plant cover within a grid shifted populations toward adult plants with limited juveniles (<xref ref-type="fig" rid="figA.7">fig. A7</xref>). Grids with more than 75-percent cover on average had fewer juveniles than adults and, therefore, could not replace themselves over time (<xref ref-type="fig" rid="figA.7">fig. A7</xref>).</p>
<fig id="figA.6" position="float" fig-type="figure"><label>Figure A6</label><caption><p>Based on field surveys, decreasing total plant cover increased total adult <italic>howellii</italic> present across all sites. Line is an exponential regression with shaded 95-percent confidence interval (R<sup>2</sup>=0.57, P&lt;0.0001). Each point is a grid that contained <italic>howellii</italic> from our survey (n=154).</p><p content-type="toc">A6. Graph showing how the decreasing total plant cover increased total adult <italic>howellii</italic> present across all sites</p></caption>
<long-desc>A6.</long-desc><graphic xlink:href="sac21-4141_figA.6"/></fig>
<fig id="figA.7" position="float" fig-type="figure"><label>Figure A7</label><caption><p>Based on field observations, increased plant cover decreases the ratio of juvenile to adult <italic>howellii</italic> at field sites. The dotted horizontal line at 1 represents a plant population that can replace itself with 0-percent mortality; populations below that line may not be sustainable. Each point is a grid that contained <italic>howellii</italic> from our surveys (n=154). Total plant cover is the percent cover of the entire plant community.</p><p content-type="toc">A7. Graph showing how increased plant cover decreases the ratio of juvenile to adult howellii at field sites</p></caption>
<long-desc>A7. Black and white graph showing increased plant cover decreases the ratio of juvenile to adult howellii</long-desc><graphic xlink:href="sac21-4141_figA.7"/></fig>
<p>Given the strong relationship between total plant cover and number of <italic>howellii</italic> individuals, we modeled the acreage that would be necessary to reach adult <italic>howellii</italic> population sizes that match USFWS recovery criteria (draft at time of analysis, now finalized; <xref ref-type="bibr" rid="r-1-25">U.S. Fish and Wildlife Service, 2019</xref>): 1,500 or 4,800 (<xref ref-type="table" rid="tA.3">table A3</xref>). 25-percent cover closely represents dune habitat, while 75-percent cover most closely represents an invaded annual grass habitat. A habitat at 90-percent cover is highly invaded. To support the same population of 4,800 individuals, a highly invaded habitat would require an order of magnitude more acreage (181&#x2013;327 acres) than a dune habitat (13&#x2013;22 acres; <xref ref-type="table" rid="tA.3">table A3</xref>).</p>
<table-wrap id="tA.3" position="float">
<label>Table A3</label><caption><title>Modeled acreage needed to reach an adult <italic>howellii</italic> population size of 1,500 and 4,800 individuals.<?Table Small?></title>
<p content-type="toc">A3. Modeled acreage needed to reach an adult <italic>howellii</italic> population size of 1,500 and 4,800 individuals</p>
<p>[Total plant cover is the percent cover of the entire plant community. Acres presented as means with 95-precent confidence intervals in parentheses.]</p>
</caption>
<table rules="groups">
<col width="30.52%"/>
<col width="32.91%"/>
<col width="36.57%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Total plant cover (percentage)</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Acres needed for population of 1,500</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Acres needed for population of 4,800</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt" scope="row">5</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">2 (2&#x2013;3)</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">7 (5&#x2013;10)</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">25</td>
<td valign="top" align="center">5 (4&#x2013;7)</td>
<td valign="top" align="center">17 (13&#x2013;22)</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">50</td>
<td valign="top" align="center">15 (12&#x2013;18)</td>
<td valign="top" align="center">47 (39&#x2013;57)</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">75</td>
<td valign="top" align="center">41 (32&#x2013;52)</td>
<td valign="top" align="center">131 (103&#x2013;167)</td>
</tr>
<tr>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt" scope="row">90</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">76 (57&#x2013;102)</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">243 (181&#x2013;327)</td>
</tr>
</tbody></table></table-wrap>
<p>High density <italic>howellii</italic> populations were found within a distinct range of NDVI values. In grids with NDVI less than 0.1, there was a relationship between NDVI and <italic>howellii</italic> adult plant density; with high NDVI (indicating high plant cover); however, there was no relationship to adult plant density and few plants were found (<xref ref-type="fig" rid="figA.8">fig. A8</xref>). Additionally, NDVI spatial patterns mirrored those found with total plant community cover and high <italic>howellii</italic> plant densities (<xref ref-type="fig" rid="figA.9">fig. A9</xref>). Low plant cover and sandy habitat, such as the constructed dune restoration site on ADNWR Stamm Unit, had low NDVI values indicating high habitat quality, whereas the more invaded sites had higher values, indicating poor habitat quality (<xref ref-type="fig" rid="figA.9">figs. A9</xref>&#x2013;10).</p>
<fig id="figA.8" position="float" fig-type="figure"><label>Figure A8</label><caption><p>Breakpoint analysis of the relationship between normalized difference vegetation index (NDVI) and adult <italic>howellii</italic> density. Each point represents a grid where at least one plant was found (n=154). Breakpoint=0.1. Line is segmented regression.</p><p content-type="toc">A8. Graph showing breakpoint analysis of the relationship between normalized difference vegetation index and adult <italic>howellii</italic> density</p></caption>
<long-desc>A8. Breakpoint analysis of the relationship between normalized difference vegetation index and adult howellii density</long-desc><graphic xlink:href="sac21-4141_figA.8"/></fig>
<fig id="figA.9" position="float" fig-type="figure"><label>Figure A9</label><caption><p>Continuous and categorized normalized difference vegetation index (NDVI) at Antioch Dunes National Wildlife Refuge Stamm Unit. Categorized NDVI (left) uses break from breakpoint analysis (0.1) to highlight quality habitat in green.</p><p content-type="toc">A9. Images showing continuous and categorized normalized difference vegetation index at Antioch Dunes National Wildlife Refuge Stamm Unit</p></caption>
<long-desc>A9. Continuous and categorized normalized difference vegetation index at Antioch Dunes National Wildlife Refuge Stamm Unit.</long-desc><graphic xlink:href="sac21-4141_figA.9"/></fig>
<fig id="figA.10" position="float" fig-type="figure"><label>Figure A10</label><caption><p>Categorized normalized difference vegetation index (NDVI) across all sites surveyed with a grid system. Categories chosen by breakpoint analysis (break=&lt;0.1), to indicate high quality habitat in green. Normalized difference vegetation index (NDVI) is a metric of greenness and plant density, where lower values typically represent low plant density.</p><p content-type="toc">A10. Images showing categorized normalized difference vegetation index across all sites surveyed with a grid system</p></caption>
<long-desc>A10. Categorized normalized difference vegetation index across all sites surveyed with a grid system (Browns Island, City of Oakley Parcel, Brannan Island, Antioch Dunes National Wildlife Refuge Stamm Unit, and Antioch Dunes National Wildlife Refuge Sardis Unit)</long-desc><graphic xlink:href="sac21-4141_figA.10"/></fig>
<p>Unconsolidated entisols (mineral soils that have not differentiated into distinct horizons) underlie the survey region where interior dune communities were common pre-development (<xref ref-type="fig" rid="figA.11">fig. A11</xref>). Total acreage of the historical sand sheet was 34.4 square kilometers (km<sup>2</sup>). Using 2018 imagery, the acreage of habitat within the historical sand sheet that has a modern NDVI within the range that supports <italic>howellii</italic> is 12.9 km<sup>2</sup> (<xref ref-type="fig" rid="figA.12">fig. A12</xref>). With developed land removed, there is a maximum of 5.6 km<sup>2</sup> available that may support <italic>howellii</italic>, although this is an upper bound because it includes currently cultivated land (<xref ref-type="fig" rid="figA.13">fig. A13</xref>). Normalized difference vegetation index values are likely to represent urban landforms and not quality dune habitat because most of the land within the NDVI range is developed (<xref ref-type="fig" rid="figA.14">fig. A14</xref>).</p>
<fig id="figA.11" position="float" fig-type="figure"><label>Figure A11</label><caption><p>Spatial coverage of historical interior dune habitat (left) and entisols (right) in the Antioch region. Habitat type data from <xref ref-type="bibr" rid="r-1-18">Stanford and others (2011)</xref> and soil type data from Soil Survey Geographic Database (2019).</p><p content-type="toc">A11. Images showing spatial coverage of historical interior dune habitat and entisols in the Antioch region</p></caption>
<long-desc>A11. Spatial coverage of historical interior dune habitat (on left) and entisols (on right) in the Antioch region</long-desc><graphic xlink:href="sac21-4141_figA.11"/></fig>
<fig id="figA.12" position="float" fig-type="figure"><label>Figure A12</label><caption><p>Areas identified as suitable habitat using normalized difference vegetation index (NDVI) within the historical Antioch sand sheet.</p><p content-type="toc">A12. Map showing areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet</p></caption>
<long-desc>A12. Areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet</long-desc><graphic xlink:href="sac21-4141_figA.12"/></fig>
<fig id="figA.13" position="float" fig-type="figure"><label>Figure A13</label><caption><p>Areas identified as suitable habitat using normalized difference vegetation index (NDVI) within the historical Antioch sand sheet with all classes (low, medium, high) of developed land cover removed</p><p content-type="toc">A13. Map showing areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet with all classes of developed land cover removed</p></caption>
<long-desc>A13. Areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet with all classes (low, medium, high) of developed land cover removed</long-desc><graphic xlink:href="sac21-4141_figA.13"/></fig>
<fig id="figA.14" position="float" fig-type="figure"><label>Figure A14</label><caption><p>Percentage of areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet classified by land cover category.</p><p content-type="toc">A14. Pie chart showing percentage of areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet classified by land cover category</p></caption>
<long-desc>A14. Percentage of areas identified as suitable habitat using normalized difference vegetation index within the historical Antioch sand sheet classified by land cover category (pasture/hay, 2 percent; bare land, 2 percent; cultivated, 8 percent; developed open space, 6 percent; grassland, 25 percent; high intensity developed, 6 percent; low intensity developed, 23 percent; medium intensity developed, 29 percent)</long-desc><graphic xlink:href="sac21-4141_figA.14"/></fig>
</sec>
</sec>
<sec>
<title>Discussion</title>
<sec>
<title>Dune Construction</title>
<p>Our results indicated that habitat creation, such as that undertaken at the Stamm Management Area 1 of ADNWR, has the potential to increase <italic>howellii</italic> populations. We found the highest population densities on the constructed dune habitat and the highest juvenile to adult ratios. The dune is not dispersal-limited because thousands of individuals naturally recruited into the site within a year of restoration. The proximity to other protected habitat may underpin the lack of dispersal barriers; constructed sites located far from any source populations may not show the same success because of lack of pollinators or other constraints (<xref ref-type="bibr" rid="r-1-14">Pavlik and others, 1993</xref>). When dredge spoil or other dune construction projects occur beyond the natural dispersal range of <italic>howellii</italic>, populations could still be viable if transplanted. The Brannan Island <italic>howellii</italic> population, for example, occurs on old dredge spoil from the 1920s (<xref ref-type="bibr" rid="r-1-21">U.S. Fish and Wildlife Service, 2002</xref>; <xref ref-type="bibr" rid="r-1-5">California Department of Parks and Recreation, 2019</xref>). Dune construction can be effective by providing open space with mobile sand while reducing competition from other species, which are key drivers of juvenile germination or establishment (<xref ref-type="bibr" rid="r-1-13">Pavlik and Manning, 1993</xref>; <xref ref-type="bibr" rid="r-1-9">Greene, 1995</xref>).</p>
</sec>
<sec>
<title>Habitat Management</title>
<p>We found strong relationships between total plant community cover and <italic>howellii</italic> population size and demography. Total plant cover therefore could be a quantifiable indicator of habitat quality for <italic>howellii</italic> and is relatively easy to measure in the field. Management of existing habitat to reduce total plant cover may increase <italic>howellii</italic> populations and shift demography toward juveniles. The difference in distribution and demography of juvenile <italic>howellii</italic> between areas with bare ground and those with high total plant cover supports previous findings that bare, sandy ground is important for juvenile success (<xref ref-type="bibr" rid="r-1-13">Pavlik and Manning, 1993</xref>; <xref ref-type="bibr" rid="r-1-9">Greene, 1995</xref>; <xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>). Populations in areas with low total plant cover had higher proportions of juveniles and therefore a better chance of growing or stable populations over time, compared to areas with high total plant cover made up mostly of adult plants. Because <italic>howellii</italic> is a short-lived perennial, recruitment is a key demographic transition for population growth and one that may be facilitated by low plant cover (<xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>).</p>
<p>The mechanisms underlying the impact of total plant cover on juvenile recruitment are unclear. It could be that light is necessary for successful germination or that invasive grasses and other vegetation compete strongly for water or nutrients to prevent successful establishment of seedlings (<xref ref-type="bibr" rid="r-1-14">Pavlik and others, 1993</xref>; <xref ref-type="bibr" rid="r-1-9">Greene, 1995</xref>). Disturbance of the soil also could be necessary for germination (<xref ref-type="bibr" rid="r-1-19">Thomson, 2005</xref>) because dune stabilization by vegetation may reduce sand action that scarifies the seed coat to promote germination. Experimental seedbank germination studies are needed to test if <italic>howellii</italic> is present in invaded habitat but isn&#x2019;t germinating because of dune stabilization (for example, competition or reduced light). If present in invaded habitat seedbanks, restoration activities that reduce total plant cover could be successful in jumpstarting <italic>howellii</italic> populations. Additionally, field studies that test the effect of total plant cover on seedling establishment and recruitment, and greenhouse studies that test the effects of light, nutrients, and water availability separately are necessary to fully disentangle the mechanisms by which plant cover influences <italic>howellii</italic> population demography. These studies are especially crucial in locations where adult and juvenile plants are present and land management activities that reduce plant cover are feasible. One possibility is that detection of juveniles is lower in invaded habitats because of difficulty in locating individuals; explicit tests of surveyor detection error are needed to constrain this possibility.</p>
</sec>
<sec>
<title>Potential Available Habitat</title>
<p>The original extent of habitat that may have supported <italic>howellii</italic> or similar dune specialist species covered a broad range in the Antioch area. With the sand sheet area now under fast-paced development, the potential available habitat for dune specialists is much reduced and declining quickly. Our map of potential quality habitat gives a baseline search extent for further analysis that could potentially pinpoint habitat that can support <italic>howellii</italic>. Identifying NDVI values between &#x2212;0.1 and 0.1 with low variation across time within this extent will allow further reduction of the focus area and direct attention on land parcels that may hold relict populations or could potentially support outplanting operations. The analyses presented here provide maximum potential habitat; future analyses will need to verify and constrain broad land cover classes to remove roads, levees, and other landforms not conducive to plant populations of concern.</p>
</sec>
<sec>
<title>Considerations</title>
<p>Regardless of whether habitat creation or habitat management is used, the total acreage necessary to sustain populations of adult <italic>howellii</italic> is greatly reduced when that habitat has low total plant cover. To sustain population sizes matching delisting criteria (2 populations of 1,500 and 5 populations of 4,800 [15-year moving median]; <xref ref-type="bibr" rid="r-1-25">U.S. Fish and Wildlife Service, 2019</xref>), quality of habitat is important. Modeling suggests 95 (95-percent confidence interval: 74&#x2013;122) total acres are needed if the habitat is high quality with low (25 percent) total plant cover (<xref ref-type="fig" rid="figA.2">figs. A2</xref><italic>A</italic>, <xref ref-type="fig" rid="figA.15">A15</xref>) and 1,369 (95-percent confidence interval: 1,017&#x2013;1,842) total acres are required if the habitat is highly invaded with high (90 percent) total plant cover (<xref ref-type="fig" rid="figA.2">figs. A2<italic>C</italic></xref>, <xref ref-type="fig" rid="figA.15">A15</xref>).</p>
<fig id="figA.15" position="float" fig-type="figure"><label>Figure A15</label><caption><p>Total acres needed to sustain 2 populations of 1,500 and 5 populations of 4,800 adult <italic>howellii</italic> individuals (27,000 total adults) over ranges of total plant community cover. Increasing plant community cover exponentially increases acres needed to sustain populations.</p><p content-type="toc">A15. Graph showing total acres needed to sustain 2 populations of 1,500 and 5 populations of 4,800 adult <italic>howellii</italic> individuals over ranges of total plant community cover</p></caption>
<long-desc>A15. Total acres needed to sustain 2 populations of 1,500 and 5 populations of 4,800 adult howellii individuals over ranges of total plant community cover</long-desc><graphic xlink:href="sac21-4141_figA.15"/></fig>
</sec>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>This work was supported by the U.S. Fish and Wildlife Service Bay-Delta Fish and Wildlife Office, Friends of San Pablo Bay National Wildlife Refuge, Antioch Dunes National Wildlife Refuge, and the U.S. Geological Survey Western Ecological Research Center. For help with site logistics and general information, we would like to thank J. de la Cruz and J. McMurray from the city of Oakley; M. Ferrell from California Department of Water Resources; L. Terrazas, D. Brubaker, and S. Euing from the U.S. Fish and Wildlife Service Antioch Dunes National Wildlife Office; M. Moran and R. Pulizzi from Big Break Regional Shoreline; A. Janke from the city of Walnut Creek; B. O&#x2019;Brien, T. Fitanides, and B. Anderson from the Regional Parks Botanic Garden; R. O&#x2019;Dell from the Bureau of Land Management; D. Lake from East Bay California Native Plant Society; T. Barry and E. Dean from the University of California Davis Center for Plant Diversity Herbarium; the Contra Costa Water District; K. Heffernan and F. Takahashi from San Luis National Wildlife Refuge Complex; M. Hammond and C. Lare-Masters from East Bay Regional Park District; and V. Stewart from the San Francisco Botanical Garden.</p>
</ack>
<ref-list>
<title>References Cited</title>
<ref id="r-1-1"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Atwater</surname>, <given-names>B.F.</given-names></string-name></person-group>, <year>1982</year>, <source>Geologic factors in the prehistoric establishment of organisms endemic to eolian dunes near Antioch</source>: <publisher-loc>California</publisher-loc>, <publisher-name>U.S. Geological Survey</publisher-name>, <size units="page">6</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-2"><mixed-citation publication-type="other">Cain, J., Beamish, S., Walkling, R., and Cheng, E., 2004, Dutch Slough Tidal Marsh restoration project preliminary opportunities and constraints report: Prepared by Natural Heritage Institute for the California State Coastal Conservancy, 63 p.</mixed-citation></ref>
<ref id="r-1-3"><mixed-citation publication-type="other">California Consortium of Herbaria, 2019, Entries for Oenothera deltoides subsp. howellii: California Consortium of Herbaria database, accessed 2019, at <ext-link ext-link-type="uri" xlink:href="http://ucjeps.berkeley.edu/consortium/">http://ucjeps.berkeley.edu/consortium/</ext-link>.</mixed-citation></ref>
<ref id="r-1-4"><mixed-citation publication-type="other">California Department of Fish and Wildlife, 2018, Entry for Oenothera deltoides subsp. howellii. California Natural Diversity Database: California Department of Fish and Wildlife, accessed 2018.</mixed-citation></ref>
<ref id="r-1-5"><mixed-citation publication-type="web">California Department of Parks and Recreation, 2019, Brannan Island state recreation area history, at Brannan Island state recreation area: California Department of Parks and Recreation web page, <ext-link ext-link-type="uri" xlink:href="http://www.parks.ca.gov/?page_id=1319">www.parks.ca.gov/?page_id=1319</ext-link>.</mixed-citation></ref>
<ref id="r-1-6"><mixed-citation publication-type="other">Center for Plant Conservation, 2014, Entry for Oenothera deltoides subsp. howellii. National Collection database: Center for Plant Conservation, accessed 2019.</mixed-citation></ref>
<ref id="r-1-7"><mixed-citation publication-type="other">East Bay Chapter of the California Native Plant Society, 2019, Entry for Oenothera <italic>deltoides</italic> subsp. <italic>howellii</italic>. Rare, Unusual, and Significant Plants of Alameda and Contra Costa Counties database: East Bay chapter of the California Native Plant Society, accessed 2019.</mixed-citation></ref>
<ref id="r-1-8"><mixed-citation publication-type="web">Environmental Systems Research Institute (ESRI), 2011, ArcGIS Release 10.1: Redlands, Calif., Environmental Systems Research Institute, <ext-link ext-link-type="uri" xlink:href="https://www.esri.com/en-us/home">https://www.esri.com/en-us/home</ext-link>.</mixed-citation></ref>
<ref id="r-1-9"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Greene</surname>, <given-names>J.A.</given-names></string-name></person-group>, <year>1995</year>, <source>Three reproductive ecology studies in the narrow endemic <italic>Oenothera deltoides</italic> ssp. <italic>howellii</italic> (Onagraceae)</source>: <publisher-loc>Claremont, CA</publisher-loc>, <publisher-name>Claremont Graduate University</publisher-name>, <size units="page">39</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-10"><mixed-citation publication-type="other">Mathers, J., and U.S. Fish and Wildlife Service, 2018, Antioch Dunes national wildlife refuge 2017 vegetation inventory: Shelterbelt Builders Inc., 114 p.</mixed-citation></ref>
<ref id="r-1-11"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>McNally</surname>, <given-names>A.M.</given-names></string-name></person-group>, <year>2014</year>, <source>Historical geography of the Antioch Dunes, Antioch, California, with a focus on current impacts to the habitat and population of the federally endangered Lange&#x2019;s Metalmark Butterfly (<italic>Apodemia mormo langei</italic>)</source>: <publisher-loc>Davis, Calif.</publisher-loc>, <publisher-name>University of California</publisher-name>, <size units="page">194</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-12"><mixed-citation publication-type="other">Ontario Agricultural College BIO Herbarium, 2019, Entries for Oenothera deltoides subsp. howellii: BIO Herbarium at the University of Guelph, accessed 2019, at <pub-id pub-id-type="doi">https://www.gbif.org/dataset</pub-id>https://www.gbif.org/dataset.</mixed-citation></ref>
<ref id="r-1-13"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Pavlik</surname>, <given-names>B.M.</given-names></string-name>, and <string-name><surname>Manning</surname>, <given-names>E.</given-names></string-name></person-group>, <year>1993</year>, <article-title>Assessing limitations on the growth of endangered plant populations, I. Experimental demography of <italic>Erysimum capitatum ssp. angustatum</italic> and <italic>Oenothera deltoides</italic> ssp. <italic>howellii</italic></article-title>: <source>Biological Conservation</source>, v.&#x00A0;<volume>65</volume>, no.&#x00A0;<issue>3</issue>, p.&#x00A0;<fpage>257</fpage>&#x2013;<lpage>265</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1016/0006-3207(93)90058-9</pub-id>.</mixed-citation></ref>
<ref id="r-1-14"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Pavlik</surname>, <given-names>B.M.</given-names></string-name>, <string-name><surname>Ferguson</surname>, <given-names>N.</given-names></string-name>, and <string-name><surname>Nelson</surname>, <given-names>M.</given-names></string-name></person-group>, <year>1993</year>, <article-title>Assessing limitations on the growth of endangered plant populations, II. Seed production and seed bank dynamics of <italic>Erysimum capitatum</italic> ssp. <italic>angustatum</italic> and <italic>Oenothera deltoides</italic> ssp. <italic>howellii</italic></article-title>: <source>Biological Conservation</source>, v.&#x00A0;<volume>65</volume>, no.&#x00A0;<issue>3</issue>, p.&#x00A0;<fpage>267</fpage>&#x2013;<lpage>278</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1016/0006-3207(93)90059-A</pub-id>.</mixed-citation></ref>
<ref id="r-1-15"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Powell</surname>, <given-names>J.A.</given-names></string-name></person-group>, <year>1983</year>, <source>Changes in the insect fauna of a deteriorating riverine sand dune community during 50 years of human exploitation</source>: <publisher-name>University of California Berkeley</publisher-name>, <size units="page">80</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-16"><mixed-citation publication-type="web">R Core Team, 2016, R&#x2014;A language and environment for statistical computing, ver. 3.2.2, <ext-link ext-link-type="uri" xlink:href="https://www.R-project.org/">https://www.R-project.org/</ext-link>.</mixed-citation></ref>
<ref id="r-1-17"><mixed-citation publication-type="web">Soil Survey Geographic Database, 2019, Web soil survey: Natural Resources Conservation Service, U.S. Department of Agriculture, accessed 2019, at <ext-link ext-link-type="uri" xlink:href="https://websoilsurvey.nrcs.usda.gov/">https://websoilsurvey.nrcs.usda.gov/</ext-link>.</mixed-citation></ref>
<ref id="r-1-18"><mixed-citation publication-type="book">Stanford, B., Grossinger, R.M., Askevold, R.A., Whipple, A., Leidy, R.A., Beller, E.E., Salomon, M., and Striplen, C.J., 2011, East Contra Costa County historical ecology study: Oakland, Calif., San Francisco Estuary Institute 648, 126 p.</mixed-citation></ref>
<ref id="r-1-19"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Thomson</surname>, <given-names>D.M.</given-names></string-name></person-group>, <year>2005</year>, <article-title>Measuring the effects of invasive species on the demography of a rare endemic plant</article-title>: <source>Biological Invasions</source>, v.&#x00A0;<volume>7</volume>, no.&#x00A0;<issue>4</issue>, p.&#x00A0;<fpage>615</fpage>&#x2013;<lpage>624</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1007/s10530-004-5853-3</pub-id>.</mixed-citation></ref>
<ref id="r-1-20"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>1984</year>, <source>Revised recovery plan for three endangered species endemic to Antioch Dunes</source>: <publisher-loc>California</publisher-loc>, <publisher-name>U.S. Fish and Wildlife Service</publisher-name>, <size units="page">71</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-21"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>2002</year>, <source>Antioch Dunes national wildlife refuge comprehensive conservation plan</source>. <publisher-name>U.S. Fish and Wildlife Service</publisher-name>, <size units="page">86</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-22"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>2008</year>, <source>Lange&#x2019;s metalmark butterfly, Antioch Dunes evening-primrose, and Contra Costa wallflower 5-year review&#x2014;Summary and evaluation</source>: <publisher-loc>Sacramento, Calif.</publisher-loc>, <publisher-name>U.S. Fish and Wildlife Service</publisher-name>, <size units="page">37</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-1-23"><mixed-citation publication-type="other">U.S. Fish and Wildlife Service, 2017, 2017 activities involving the Antioch Dunes Evening Primrose at Antioch Dunes National Wildlife Refuge: U.S. Fish and Wildlife Service unpublished data summary.</mixed-citation></ref>
<ref id="r-1-24"><mixed-citation publication-type="other">U.S. Fish and Wildlife Service, 2018, 2018 ADEP survey in New Dune site section 1: U.S. Fish and Wildlife Service unpublished data summary.</mixed-citation></ref>
<ref id="r-1-25"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>2019</year>, <source>Recovery plan amendment&#x2014;Revised recovery plan for three endangered species endemic to Antioch Dunes</source>: <publisher-loc>California</publisher-loc>, <publisher-name>San Francisco Bay-Delta Fish and Wildlife Office, Sacramento, California</publisher-name>.</mixed-citation></ref>
<ref id="r-1-26"><mixed-citation publication-type="other">Wong, R., and Kolar, M., 2002, Wildlife fire management plan Antioch Dunes National Wildlife Refuge: U.S. Fish and Wildlife Service, 84 p.</mixed-citation></ref>
</ref-list>
<app>
<title>Appendix A1. Additional Literature</title>
<ref-list>
<ref id="r-2-1"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Evans</surname>, <given-names>M.E.K.</given-names></string-name>, <string-name><surname>Hearn</surname>, <given-names>D.J.</given-names></string-name>, <string-name><surname>Hahn</surname>, <given-names>W.J.</given-names></string-name>, <string-name><surname>Spangle</surname>, <given-names>J.M.</given-names></string-name>, and <string-name><surname>Venable</surname>, <given-names>D.L.</given-names></string-name></person-group>, <year>2005</year>, <article-title>Climate and life&#x2010;history evolution in evening primroses (Oenothera, Onagraceae)&#x2014;A phylogenetic comparative analysis</article-title>: <source>Evolution; International Journal of Organic Evolution</source>, v.&#x00A0;<volume>59</volume>, no.&#x00A0;<issue>9</issue>, p.&#x00A0;<fpage>1914</fpage>&#x2013;<lpage>1927</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1111/j.0014-3820.2005.tb01061.x</pub-id>.</mixed-citation></ref>
<ref id="r-2-2"><mixed-citation publication-type="other">Klein, W.M., 1962, New taxa and recombinations in <italic>Oenothera</italic> (Anogra): Aliso&#x2014;A Journal of Systematic and Evolutionary Botany, v. 5, no. 2, p. 179&#x2013;180.</mixed-citation></ref>
</ref-list>
</app>
<app>
<title>Appendix A2. Shapefiles of Individual Leica Real-Time Kinematic (RTK) Global Positioning System (x, y) Location Points Taken at Off-Refuge Sites</title>

<p>Available as an electronic file from <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3133/ofr20211017">https://doi.org/10.3133/ofr20211017</ext-link>.</p>

</app>
</back>
</book-part>
<book-part>
<book-part-meta>
<title-group>
<title>Chapter B. Population Genomic Structure of the Endangered Antioch Dunes Evening-Primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>) and Detection of a Potentially New <italic>Oenothera deltoides</italic> Taxon in Contra Costa County, California</title>
</title-group>
<contrib-group content-type="chapter-authors">
<contrib contrib-type="author"><string-name><x>By</x><x> </x><given-names>Elizabeth R.</given-names><x> </x><surname>Milano</surname></string-name><x>, </x></contrib>
<contrib contrib-type="author"><string-name><given-names>Amy G.</given-names><x> </x><surname>Vandergast</surname></string-name></contrib>
</contrib-group>
</book-part-meta>
<body>
<sec>
<title>Executive Summary</title>
<list id="L3" list-type="bullet">
<list-item><label>&#x2022;</label><p>Our study goals were to assess the distribution of genetic diversity within and among occurrences of <italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic> (hereafter, <italic>howellii</italic>) and explore its evolutionary relationship to a putative new taxon with an adjacent distribution using genome-wide genetic markers.</p></list-item>
<list-item><label>&#x2022;</label><p>We analyzed samples from eight <italic>howellii</italic> occurrences and from three occurrences of the unknown taxon on the Antioch sand sheet. These plants exhibited morphological characteristics intermediate between <italic>howellii</italic> and the closely related <italic>Oenothera deltoides</italic> subsp. <italic>cognata</italic> (hereafter, <italic>cognata</italic>). Samples from three <italic>cognata</italic> occurrences in the San Joaquin Valley also were included.</p></list-item>
<list-item><label>&#x2022;</label><p>Double-digest restriction-site associated deoxyribonucleic acid (DNA) sequencing resulted in 2,694 independent loci analyzed across 212 individuals distributed across 14 occurrences.</p></list-item>
<list-item><label>&#x2022;</label><p>Among <italic>howellii</italic> occurrences, genetic diversity was greatest at all three sampling locations on the Refuge.</p></list-item>
<list-item><label>&#x2022;</label><p>Population genomic structure analyses identified all <italic>howellii</italic> occurrences as a single genetic cluster and a second, unique cluster consisting of plants from Dutch Slough and two other occurrences on the Antioch sand sheet, hereafter, clade X. These two genetic clusters were distinct from sampled occurrences of <italic>cognata</italic>.</p></list-item>
<list-item><label>&#x2022;</label><p>Phylogenetic analysis confirmed that these three groups form distinct, well-supported, monophyletic clades.</p></list-item>
<list-item><label>&#x2022;</label><p>We did not find any hybrid individuals or evidence of recent gene exchange between any of the three lineages.</p></list-item></list>
</sec>
<sec>
<title>Introduction</title>
<p>The Antioch Dunes evening-primrose <italic>(Oenothera deltoides</italic> subsp. <italic>howellii;</italic> hereafter <italic>howellii</italic>) is a subspecies of birdcage evening primrose (<italic>Oenothera deltoides;</italic> Onagraceae; <xref ref-type="bibr" rid="r-3-16">Klein, 1962</xref>). Described subspecies within <italic>O. deltoides</italic> have disjunct distributions in habitats characterized by different California climate zones (<xref ref-type="bibr" rid="r-3-7">Evans and others, 2009</xref>). <italic>Howellii</italic>&#x2019;s distribution is limited to the dunes near Antioch in a Mediterranean climate, whereas the nearest geographical clade member, <italic>O. deltoides</italic> subsp. <italic>cognata</italic> (hereafter <italic>cognata</italic>), has a much larger distribution in the San Joaquin Valley in a more arid and desert-like climate (<xref ref-type="bibr" rid="r-3-17">Klein, 1970</xref>). Past climate conditions that brought the now-separate lineages together could have played a role in subspecies differentiation in the <italic>O. deltoides</italic> complex (<xref ref-type="bibr" rid="r-3-11">Greene, 1995</xref>; <xref ref-type="bibr" rid="r-3-7">Evans and others, 2009</xref>). Members of the species can be differentiated morphologically based on leaf, flower, and bud characteristics (<xref ref-type="bibr" rid="r-3-18">Munz, 1949</xref>).</p>
<p>When listed as federally endangered in 1978, there were small occurrences of <italic>howellii</italic> in the Antioch Dunes area of Contra Costa County, representing just 10 percent of the original riverine sand dune habitat (<xref ref-type="bibr" rid="r-3-24">U.S. Fish and Wildlife Service, 2008</xref>). The majority of <italic>howellii</italic> are located on the Antioch Dunes National Wildlife Refuge (ADNWR), with smaller occurrences on Brannan Island, Browns Island, and in the Regional Parks Botanic Garden, all of which were outplanted in the 1970s (<xref ref-type="bibr" rid="r-3-24">U.S. Fish and Wildlife Service, 2008</xref>). On ADNWR, population sizes generally decreased over the past three decades (<xref ref-type="bibr" rid="r-3-25">U.S. Fish and Wildlife Service, 2020</xref>). However, very recently, plant abundance increased substantially on a sand dune restoration adjacent to existing plants on the Stamm Unit, suggesting that open, disturbed dune habitat is beneficial to this subspecies (chapter A). Regional surveys conducted in 2019 found a new, presumed natural occurrence of <italic>howellii</italic> on a small City of Oakley Parcel, designated as a preserve for legless lizards (chapter A). Furthermore, these surveys uncovered additional populations of birdcage evening-primrose that could not be keyed out. These plants had leaf and flower characteristics that appeared intermediate between <italic>howellii</italic> and <italic>cognata.</italic></p>
<p>Given the small number and disjunct distribution of populations, a history of population declines, previous outplantings, and the possibility of a closely distributed related taxon or hybrid, an understanding of the genetic structure and diversity within <italic>howellii</italic> and in relation to its closest relatives could inform future management of this taxon. Estimates of genetic diversity can identify occurrences that would benefit from targeted restoration efforts as well as provide a snapshot for monitoring genetic diversity trends over time in response to future disturbances or restoration actions (<xref ref-type="bibr" rid="r-3-8">Frankham and others, 2017</xref>). Population and phylogenetic structure can identify distinct genetic lineages and give insight into the geographic scale of gene flow (<xref ref-type="bibr" rid="r-3-13">Hughes and others, 2008</xref>; <xref ref-type="bibr" rid="r-3-5">Engelhardt and others, 2014</xref>). The genus <italic>Oenothera</italic> has a long history as a model organism for non-mendelian inheritance (<xref ref-type="bibr" rid="r-3-10">Golczyk and others, 2008</xref>, <xref ref-type="bibr" rid="r-3-9">2014</xref>), cytoplasmic genetics (<xref ref-type="bibr" rid="r-3-3">Chiu and Sears, 1993</xref>), and chromosome evolution (<xref ref-type="bibr" rid="r-3-4">Cleland, 1972</xref>), among other topics (reviewed in, <xref ref-type="bibr" rid="r-3-14">Johnson, 2011</xref>). However, no prior molecular genetic data exists for <italic>howellii,</italic> aside from a phylogeny of <italic>Oenothera</italic> sections <italic>Anogra</italic> and <italic>Kleinia</italic> (Onagraceae; <xref ref-type="bibr" rid="r-3-6">Evans and others, 2005</xref>, <xref ref-type="bibr" rid="r-3-7">2009</xref>). Developing specific <italic>howellii</italic> genomic markers for population genomic analysis can play a key role in the conservation of this endangered taxon.</p>
<sec>
<title>Goals and Objectives</title>
<p>This project was designed as a companion to the field surveys documenting distribution and abundance of <italic>howellii</italic> described in chapter A. Our study goals were to assess the distribution of genetic diversity within and among occurrences of <italic>howellii</italic> and explore its evolutionary relationship to the putative new taxon with an adjacent distribution on the Antioch sand sheet by using genome-wide genetic markers.Specifically, we:</p>
<list id="L4" list-type="bullet">
<list-item><label>&#x2022;</label><p>Describe genetic structure among surveyed occurrences of <italic>howellii,</italic></p></list-item>
<list-item><label>&#x2022;</label><p>Describe patterns of genetic diversity within occurrences of <italic>howellii</italic>, and</p></list-item>
<list-item><label>&#x2022;</label><p>Investigate a putative new taxon in <italic>O. deltoides</italic> to determine if it represents a recent hybrid with <italic>cognata</italic>.</p></list-item></list>
</sec>
</sec>
<sec>
<title>Methods</title>
<sec>
<title>Site Collections</title>
<p>Leaf tissue was collected from all extant <italic>howellii</italic> occurrences (chapter A): Antioch Dunes National Wildlife Refuge (ADNWR Stamm dune in Management Area 1, Stamm excluding dune in Management Area 1, and Sardis Units considered separately), Brannan Island State Recreation Area, Browns Island, and City of Oakley Parcel (preserve for legless lizards). Samples also were collected from the Regional Parks Botanic Garden collection, and from cultivated plants obtained from Annie&#x2019;s Nursery (<ext-link ext-link-type="uri" xlink:href="http://www.anniesannuals.com">www.anniesannuals.com</ext-link>; Richmond, California).</p>
<p>At Dutch Slough, a site that was previously thought to contain <italic>howellii</italic>, plants were morphologically distinct from <italic>howellii</italic> observed at ADNWR and other occurrences. After consulting the Jepson manual (<xref ref-type="bibr" rid="r-3-1">Baldwin and others, 2012</xref>) and herbarium specimens, it was determined that these plants appeared to have traits that were a mix between <italic>howellii</italic> and <italic>cognata</italic> (<xref ref-type="fig" rid="figB.1">fig. B1</xref>). For example, these individuals showed dentate leaf margins with green, not gray-green, strigose foliage (<italic>cognata</italic> traits) but contained free sepal tips greater than 1 millimeter (mm; <italic>howellii</italic> traits). Dutch Slough individuals also contained more variability in traits than observed at other occurrences; leaf traits were especially variable among individuals within a population. Therefore, collections were expanded to survey any occurrences of this potential hybrid or new lineage in the local area and to survey the closest geographical subspecies, <italic>cognata</italic>. In total, six occurrences were collected in addition to the original <italic>howellii</italic> occurrences. Three of these occurrences (Dutch Slough, Oakley Rose Avenue, and Big Break) contained the morphological hybrid or new taxon (clade X), and <italic>cognata</italic> was collected from three occurrences further south in the Central Valley (Corral Hollow, Monvero Dunes North and South: <xref ref-type="fig" rid="figB.2">fig. B2</xref>; <xref ref-type="table" rid="tB.1">table B1</xref>). Monvero Dunes samples were collected by Ryan O&#x2019;Dell, Bureau of Land Management, Hollister Field Office.</p>
<fig id="figB.1" position="float" fig-type="figure"><label>Figure B1</label><caption><p>Variation in plant growth form and flower and sepal characteristics of the two described <italic>O. deltoides</italic> subspecies and the unknown clade included in this study. <italic>A</italic>&#x2013;<italic>B</italic>, <italic>O. d</italic>. subsp. <italic>howellii</italic>; <italic>C</italic>&#x2013;<italic>D</italic>, clade X; <italic>E</italic>&#x2013;<italic>F</italic>, <italic>O. d</italic>. subsp. <italic>cognata</italic>. Photographs taken by Scott F. Jones, U.S. Geological Survey, May 6, 2019, to June 12, 2019.</p><p content-type="toc">B1. Photographs showing variation in plant growth form and flower and sepal characteristics of the two described <italic>O. deltoides</italic> subspecies and the unknown clade included in this study</p></caption>
<long-desc>B1. Variation in plant growth form and flower and sepal characteristics of the two described O. deltoides subspecies and the unknown clade included in this study</long-desc><graphic xlink:href="sac21-4141_figB.1"/></fig>
<fig id="figB.2" position="float" fig-type="figure"><label>Figure B2</label><caption><p>Locations sampled for genomic analysis in May and June 2019. Insert shows close-up of sampled locations on and near the Antioch Dunes National Wildlife Refuge.</p><p content-type="toc">B2. Map showing locations sampled for genomic analysis in May and June 2019</p></caption>
<long-desc>B2. Color-shaded map showing locations sampled for genomic analysis in May and June 2019. Insert shows close-up of sampled locations on and near the Antioch Dunes National Wildlife Refuge</long-desc><graphic xlink:href="sac21-4141_figB.2"/></fig>
<table-wrap id="tB.1" position="float">
<label>Table B1</label><caption><title>Occurrence summary table with type classification, location, sample size, and genetic diversity statistics.</title>
<p content-type="toc">B1. Occurrence summary table with type classification, location, sample size, and genetic diversity statistics</p>
<p>[Occurrences with asterisks were out-planted from Antioch Dunes National Wildlife Refuge (ADNWR). Sample size is the number of individuals sampled at each occurrence, private alleles is the total number of allleles only found in that occurrence. Heterozygosity (H<sub>e</sub>) is the expected heterozygosity and inbreeding (F<sub>IS</sub>) is the inbreeding coefficient. Species: <italic>howellii</italic>, <italic>Oenothera deltoides</italic> subsp.; clade X, Antioch sand sheet; <italic>cognata</italic>, <italic>Oenothera deltoides</italic> subsp. <bold>Abbreviations</bold>: SE, standard error; NA, not available]</p>
</caption>
<table rules="groups">
<col width="15.98%"/>
<col width="6.92%"/>
<col width="9.94%"/>
<col width="14.06%"/>
<col width="15.93%"/>
<col width="8.2%"/>
<col width="7.83%"/>
<col width="10.57%"/>
<col width="10.57%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Occurrence name</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Site code</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Type</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Latitude</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Longitude</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Sample size</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Private alleles</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">H<sub>e</sub> (SE)</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">F<sub>IS</sub> (SE)</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">Brown&#x2019;s Island*</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">BWI</td>
<td valign="top" align="center" style="border-top: solid 0.50pt"><italic>Howellii</italic></td>
<td valign="top" align="center" style="border-top: solid 0.50pt">38.03357472</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">&#x2013;121.8688585</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">10</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">14</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">0.096 (0.003)</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">&#x2013;0.012 (0.018)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">ADNWR&#x2014;Stamm Unit excluding dune in Management Area 1</td>
<td valign="top" align="center">AST</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">38.01525131</td>
<td valign="top" align="center">&#x2013;121.7932732</td>
<td valign="top" align="char" char=".">26</td>
<td valign="top" align="char" char=".">27</td>
<td valign="top" align="center">0.113 (0.003)</td>
<td valign="top" align="center">0.018 (0.061)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">ADNWR&#x2014;Stamm Unit on-dune in Management Area 1</td>
<td valign="top" align="center">ADU</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">38.01469852</td>
<td valign="top" align="center">&#x2013;121.7927105</td>
<td valign="top" align="char" char=".">26</td>
<td valign="top" align="char" char=".">8</td>
<td valign="top" align="center">0.112 (0.003)</td>
<td valign="top" align="center">0.0 (0.033)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">ADNWR&#x2014;Sardis Unit</td>
<td valign="top" align="center">ASA</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">38.01364132</td>
<td valign="top" align="center">&#x2013;121.7835014</td>
<td valign="top" align="char" char=".">18</td>
<td valign="top" align="char" char=".">12</td>
<td valign="top" align="center">0.113 (0.003)</td>
<td valign="top" align="center">&#x2013;0.001 (0.037)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Oakley Legless Lizard Habitat</td>
<td valign="top" align="center">OLI</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">38.00419319</td>
<td valign="top" align="center">&#x2013;121.7300397</td>
<td valign="top" align="char" char=".">11</td>
<td valign="top" align="char" char=".">3</td>
<td valign="top" align="center">0.094 (0.003)</td>
<td valign="top" align="center">&#x2013;0.029 (0.022)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Brannan Island*</td>
<td valign="top" align="center">BRI</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">38.11659249</td>
<td valign="top" align="center">&#x2013;121.6844055</td>
<td valign="top" align="char" char=".">19</td>
<td valign="top" align="char" char=".">8</td>
<td valign="top" align="center">0.094 (0.003)</td>
<td valign="top" align="center">0.004 (0.056)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Annie's Nursery</td>
<td valign="top" align="center">ANH</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">NA</td>
<td valign="top" align="center">NA</td>
<td valign="top" align="char" char=".">6</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="center">0.058 (0.003)</td>
<td valign="top" align="center">&#x2013;0.032 (0.015)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Regional Park Botanic Garden*</td>
<td valign="top" align="center">RPB</td>
<td valign="top" align="center"><italic>Howellii</italic></td>
<td valign="top" align="center">37.892893</td>
<td valign="top" align="center">&#x2013;122.242802</td>
<td valign="top" align="char" char=".">7</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="center">0.093 (0.003)</td>
<td valign="top" align="center">&#x2013;0.003 (0.016)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Big Break</td>
<td valign="top" align="center">BBR</td>
<td valign="top" align="center">Clade X</td>
<td valign="top" align="center">38.00901534</td>
<td valign="top" align="center">&#x2013;121.7281286</td>
<td valign="top" align="char" char=".">7</td>
<td valign="top" align="char" char=".">45</td>
<td valign="top" align="center">0.113 (0.003)</td>
<td valign="top" align="center">0.016 (0.013)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Rose Avenue</td>
<td valign="top" align="center">ORO</td>
<td valign="top" align="center">Clade X</td>
<td valign="top" align="center">37.9777003</td>
<td valign="top" align="center">&#x2013;121.704666</td>
<td valign="top" align="char" char=".">20</td>
<td valign="top" align="char" char=".">52</td>
<td valign="top" align="center">0.106 (0.003)</td>
<td valign="top" align="center">&#x2013;0.002 (0.054)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Dutch Slough</td>
<td valign="top" align="center">DSL</td>
<td valign="top" align="center">Clade X</td>
<td valign="top" align="center">38.00556027</td>
<td valign="top" align="center">&#x2013;121.6896543</td>
<td valign="top" align="char" char=".">17</td>
<td valign="top" align="char" char=".">101</td>
<td valign="top" align="center">0.117 (0.003)</td>
<td valign="top" align="center">0.016 (0.03)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Corral Hollow</td>
<td valign="top" align="center">CHO</td>
<td valign="top" align="center"><italic>Cognata</italic></td>
<td valign="top" align="center">37.64289459</td>
<td valign="top" align="center">&#x2013;121.4773222</td>
<td valign="top" align="char" char=".">15</td>
<td valign="top" align="char" char=".">179</td>
<td valign="top" align="center">0.07 (0.003)</td>
<td valign="top" align="center">0.019 (0.048)</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">Monvero Dunes North</td>
<td valign="top" align="center">MDN</td>
<td valign="top" align="center"><italic>Cognata</italic></td>
<td valign="top" align="center">36.53872461</td>
<td valign="top" align="center">&#x2013;120.5654169</td>
<td valign="top" align="char" char=".">12</td>
<td valign="top" align="char" char=".">177</td>
<td valign="top" align="center">0.107 (0.003)</td>
<td valign="top" align="center">0.035 (0.032)</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">Monvero Dunes South</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">MDS</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt"><italic>Cognata</italic></td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">36.46407377</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">&#x2013;120.5039034</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">13</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">145</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">0.105 (0.003)</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">0.019 (0.038)</td>
</tr>
</tbody></table></table-wrap>
</sec>
<sec>
<title>Extractions and Sequencing</title>
<p>Leaf tissue for DNA analysis was collected from 20 individuals at each occurrence, where possible and 30 individuals from ADNWR Stamm unit occurrences. For each sample, three to five leaves were collected into coin envelopes in the field and transferred to a 45-degrees Celsius (&#x00B0;C) oven until tissue was fully desiccated. Once dry, envelopes were stored with color-indicating silica gel desiccant in plastic bags inside a dessicator cabinet (Bel-Art, SP Scienceware, Wayne, New Jersey) at room temperature.</p>
<p>Genomic DNA was extracted using the E-Z 96&#x00AE; Plant DNA Kit (Omega Bio-tek Inc., Norcross, Georgia) with Antifoam Y-30 (Sigma-Aldrich, St. Louis, Missouri) added to the homogenizer plate and a 60-minute room temperature incubation before elution in 100 microliters (&#x03BC;L) of water. Reduced representation genomic libraries were prepared using a modified double-digest restriction-site associated DNA sequencing (ddRAD) scheme (<xref ref-type="bibr" rid="r-3-20">Peterson and others, 2012</xref>) in which 700 nanograms (ng) of DNA were digested with EcoRI and MseI restriction enzymes. In-line barcodes were ligated onto the EcoRI cut site and fragments were size-selected on a Pippin Prep (Sage Science, Inc., Beverly, Massachusetts) at a 400&#x00B1;30 base pair (bp) range. Each library of 12 multiplexed samples was amplified by polymerase chain reactions (PCR) for 15 cycles with the addition of a unique library index sequence. Libraries were quantified, pooled, and sequenced at the University of California, Berkeley, Vincent J. Coates Genomics Sequencing Lab (Berkeley, California) on two Illumina NovaSeq SP 100bp single-end lanes (Illumina, Inc., San Diego, California).</p>
</sec>
<sec>
<title>Bioinformatics and Population Genomic Analyses</title>
<p>Raw sequence trimming, demultiplexing, quality filtering, and genotyping was performed using Stacks v2.41 on the USGS Yeti High Performance Computing platform. Clustering, assembly, and filtering parameters were optimized using a subset of individuals following the <italic>r80</italic> method by <xref ref-type="bibr" rid="r-3-19">Paris and others (2017)</xref>. This subset was comprised of 30 percent of all samples evenly distributed across collection locations with read coverages that fell within 2 standard deviations of overall mean coverage per locus. This subset also was used to create a locus catalog (<italic>cstacks</italic>) for the full Stacks genotyping pipeline. The following parameters were used: maximum number of mismatches between stacks within individuals, M=3; maximum number of mismatches between stacks between individuals, n=3; minimum percentage of individuals across populations required to process a locus, R=0.65 (<xref ref-type="bibr" rid="r-3-2">Catchen and others, 2011</xref>). One single nucleotide polymorphism (SNP) was randomly chosen from each locus, exported in a variant call format (VCF) file, and further filtered for coverage depth by removing the bottom 1 percent, top 10 percent, and requiring 6 times the minimum coverage. Whitelists of loci and samples that passed the VCF filter were then rerun in the populations program to calculate genetic diversity statistics, including number of private alleles, expected heterozygosity (H<sub>e</sub>), inbreeding (F<sub>IS</sub>), and genetic differentiation among sampling locations (F<sub>ST</sub>).</p>
<p>Two genetic clustering analyses were used to explore the pattern of genetic structure among samples. A principal component analysis (PCA) was implemented in adegenet v2.1.3 (<xref ref-type="bibr" rid="r-3-15">Jombart, 2008</xref>) by using R v3.6.3 (<xref ref-type="bibr" rid="r-3-21">R Core Team, 2016</xref>) to visualize the genotypes in multidimensional space. FastSTRUCTURE v1.0, a Bayesian clustering method (<xref ref-type="bibr" rid="r-3-22">Raj and others, 2014</xref>), was run for values of K from 1 to 10 to identify differences in allele frequencies across populations. A range of values for the optimal number of clusters (K) was determined using the chooseK.py script in the fastSTRUCTURE package. We report pairwise F<sub>ST</sub> and H<sub>e</sub> for the identified genetic clusters and tested for differences in H<sub>e</sub> by using the adegenet function Hs.test.</p>
<p>Field observations at clade X occurrences suggested that these plants had traits that were intermediate between <italic>howellii</italic> and <italic>cognata</italic> (<xref ref-type="fig" rid="figB.1">fig. B1</xref>). We tested whether these plants represented an active hybrid zone between <italic>howellii</italic> and <italic>cognata</italic>, or a distinct taxon, using the likelihood optimization function snapclust in adegenet, with the option to explicitly model F1 (equal contributions of each parental population) and backcross (equal contributions of an F1 and a parental population) hybrids. To further investigate the lineage of clade X, we used a maximum likelihood based phylogenetic approach implemented in Raxml v8.2.12 (<xref ref-type="bibr" rid="r-3-23">Stamatakis, 2014</xref>) and executed in the CIPRES Science Gateway v3.3 (<ext-link ext-link-type="uri" xlink:href="http://www.phylo.org">www.phylo.org</ext-link>). Briefly, a concatenated gene matrix was compiled for individuals with heterozygous sites coded using standard ambiguity codes. Analyses used a single model of evolution (General Time Reversible with a gamma distributed rate variation among sites; GTR+g), were not partitioned, and were set to 100 rapid bootstrap inferences, before a thorough ML search. Resulting trees were visualized in FigTree v1.4 (<ext-link ext-link-type="uri" xlink:href="https://github.com/rambaut/figtree/releases/tag/v1.4.4">https://github.com/rambaut/figtree/releases/tag/v1.4.4</ext-link>) and highly supported bootstrap values (&gt;80) were mapped onto the most likely tree. Finally, to identify genetic loci that discriminate among clusters, a discriminant analysis of principal components (DAPC) was used to maximize the differences between genetic clusters. To determine the optimal number of principal components (PCs) to retain, we used the interactive adegenet web server to perform a cross-validation procedure with the following settings: dataset split 90-percent training set, 10-percent validation set, 30 replicates, and selected the number of PCs with the lowest root mean squared error and highest mean successful assignments. We then used an average clustering threshold to identify SNPs that load onto each discriminant axis (DA).</p>
</sec>
</sec>
<sec>
<title>Results</title>
<p>Sequenced raw read counts averaged 2.7&#x00D7;10<sup>6</sup>&#x00B1;1.6&#x00D7;10<sup>6</sup> per individual. After quality filtering and dropping low coverage samples, average read coverage per locus was 25.0&#x00D7; &#x00B1; 6.0&#x00D7;. The final genomic dataset included 207 individuals from 14 locations; 6 <italic>howellii</italic> occurrences, 3 clade X occurrences, 3 <italic>cognata</italic> occurrences, 1 <italic>howellii</italic> collection from a botanic garden, and 1 <italic>howellii</italic> collection from nursery stock (<xref ref-type="table" rid="tB.1">table B1</xref>). The dataset consisted of 2,694 independent loci with 15.41-percent missing data.</p>
<sec>
<title>Genetic Structure</title>
<p>We found minimal population structure among <italic>howellii</italic> occurrences and found that clade X and <italic>cognata</italic> occurrences form distinct genetic clusters. The first principal component (PC1) of the PCA described 14.6 percent of the total genetic variation and PC2 described 6.22 percent. There was a clear pattern of three distinct clusters where the difference between <italic>cognata</italic> and <italic>howellii</italic> was attributed to PC1 and the difference between <italic>howellii</italic> and clade X was on PC2 (<xref ref-type="fig" rid="figB.3">fig. B3</xref>). PC3 described 5.54 percent of the variation and distinguished the Corral Hollow and Monvero Dunes <italic>cognata</italic> occurrences (appendix B1). These three main clusters separated by principal component (PC) axes 1 and 2 were further supported by a fastSTRUCTURE analysis that found the optimal number of genetic clusters in the dataset was three. This analysis showed that clade X occurrences share some similarity with <italic>howellii</italic> but remain a distinct genetic group (<xref ref-type="fig" rid="figB.4">fig. B4</xref>).</p>
<fig id="figB.3" position="float" fig-type="figure"><label>Figure B3</label><caption><p>Principal component analysis where each point represents an individual, each ellipse represents a sampling occurrence, and color indicates type (red, <italic>howellii</italic>; purple, clade X; green, <italic>cognata</italic>). Eigenvalue inset shows relative proportion of variation explained by each principal component (PC) axis.</p><p content-type="toc">B3. Graph showing principal component analysis where each point represents an individual, each ellipse represents a sampling occurrence, and color indicates type</p></caption>
<long-desc>B3. Colored graph showing principal component analysis where each point represents an individual, each ellipse represents a sampling occurrence, and color indicates type (red, howellii; purple, clade X; green, cognata). Eigenvalue inset shows relative proportion of variation explained by each principal component (PC) axis</long-desc><graphic xlink:href="sac21-4141_figB.3"/></fig>
<fig id="figB.4" position="float" fig-type="figure"><label>Figure B4</label><caption><p>FastSTRUCTURE barplot where color indicates identity to each of K=3 genetic clusters (orange, <italic>howellii</italic>; purple, clade X; green, <italic>cognata</italic>), black lines separate sampled occurrences, and narrow bars represent individuals. Occurrence codes in <xref ref-type="table" rid="tB.1">table B1</xref>.</p><p content-type="toc">B4. Image showing FastSTRUCTURE barplot where color indicates identity to each of K=3 genetic clusters, black lines separate sampled occurrences, and narrow bars represent individuals</p></caption>
<long-desc>B4. Colored image showing barplot where color indicates identity to each of K=3 genetic clusters (red, howellii; purple, clade X; green, cognata), black lines separate sampled occurrences, and narrow bars represent individuals. Occurrence codes in table B1</long-desc><graphic xlink:href="sac21-4141_figB.4"/></fig>
<p>Similarly, estimates of genetic differentiation (F<sub>ST</sub>) were low among sampled <italic>howellii</italic> occurrences (range 0.02&#x2013;0.096), especially the ADNWR locations. Notably, the Regional Park Botanic Garden (RBG) samples appeared least differentiated from the ADNWR locations. The Annie&#x2019;s Nursery (ANH) sample was the most differentiated from the <italic>howellii</italic> occurrences but this could be because of its unknown cultivation history. Pairwise differentiation estimates among all occurrences were highest between Corral Hollow and non-<italic>cognata</italic> occurrences (<xref ref-type="table" rid="tB.2">table B2</xref>). We also found that <italic>cognata</italic> was more differentiated from <italic>howellii</italic> and clade X, when samples were grouped by genetic cluster, (pairwise F<sub>ST</sub> for <italic>cognata</italic>-<italic>howellii</italic>=0.085, <italic>cognata</italic>-clade X=0.087, <italic>howellii</italic>-clade X=0.043; p&lt;0.05), rather than by occurrence.</p>
<table-wrap id="tB.2" orientation="landscape" position="float">
<label>Table B2</label><caption><title>Pairwise F<sub>ST</sub> estimates by population.</title>
<p content-type="toc">B2. Pairwise F<sub>ST</sub> estimates by population</p>
<p>[Color shading from low (white) to high (blue) values of genetic differentiation. All values significant at p&lt;0.05. <bold>Abbreviations</bold>: AST, Antioch Dunes National Wildlife Refuge (ADNWR)&#x2014;Stamm Unit excluding dune in Management Area 1; ADU, ADNWR&#x2014;Stamm Unit on-dune in Management Area 1, ASA, ADNWR&#x2014;Sardis Unit; OLI, Oakley Legless Lizard Habitat; BRI, Brannan Island; ANH, Annie's Nursery; RPB, Regional Park Botanic Garden; BBR, Big Break; ORO, Rose Avenue; DSL, Dutch Slough; CHO, Corral Hollow; MDN, Monvero Dunes North; MDS, Monvero Dunes South]</p>
</caption>
<table rules="groups">
<col width="7.19%"/>
<col width="7.14%"/>
<col width="7.14%"/>
<col width="7.14%"/>
<col width="7.14%"/>
<col width="7.14%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.15%"/>
<col width="7.06%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">AST</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">ADU</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">ASA</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">OLI</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">BRI</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">ANH</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">RPB</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">BBR</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">ORO</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">DSL</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">CHO</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">MDN</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">MDS</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Site code</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(242,244,249)" scope="row">0.039</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(237,240,246)">0.046</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(236,239,246)">0.048</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(202,212,229)">0.096</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(210,218,233)">0.084</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(173,188,214)">0.138</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(210,218,232)">0.085</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(192,203,223)">0.111</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(192,203,223)">0.111</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(206,215,230)">0.091</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(99,126,176)">0.245</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(151,169,202)">0.171</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt; background-color:rgb(155,173,205)">0.164</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">BWI</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="char" char="." style="background-color:rgb(255,255,255)">0.021</td>
<td valign="top" align="char" char="." style="background-color:rgb(255,255,255)">0.021</td>
<td valign="top" align="char" char="." style="background-color:rgb(239,242,247)">0.044</td>
<td valign="top" align="char" char="." style="background-color:rgb(241,244,248)">0.04</td>
<td valign="top" align="char" char="." style="background-color:rgb(227,232,241)">0.06</td>
<td valign="top" align="char" char="." style="background-color:rgb(243,245,249)">0.037</td>
<td valign="top" align="char" char="." style="background-color:rgb(224,229,239)">0.065</td>
<td valign="top" align="char" char="." style="background-color:rgb(216,223,235)">0.076</td>
<td valign="top" align="char" char="." style="background-color:rgb(222,228,239)">0.067</td>
<td valign="top" align="char" char="." style="background-color:rgb(150,168,202)">0.172</td>
<td valign="top" align="char" char="." style="background-color:rgb(181,194,218)">0.126</td>
<td valign="top" align="char" char="." style="background-color:rgb(183,196,219)">0.124</td>
<td valign="top" align="left">AST</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(255,255,255)">0.02</td>
<td valign="top" align="char" char="." style="background-color:rgb(232,236,244)">0.053</td>
<td valign="top" align="char" char="." style="background-color:rgb(233,237,244)">0.053</td>
<td valign="top" align="char" char="." style="background-color:rgb(222,228,238)">0.068</td>
<td valign="top" align="char" char="." style="background-color:rgb(239,242,247)">0.043</td>
<td valign="top" align="char" char="." style="background-color:rgb(220,226,237)">0.071</td>
<td valign="top" align="char" char="." style="background-color:rgb(210,218,232)">0.085</td>
<td valign="top" align="char" char="." style="background-color:rgb(219,226,237)">0.071</td>
<td valign="top" align="char" char="." style="background-color:rgb(142,162,198)">0.183</td>
<td valign="top" align="char" char="." style="background-color:rgb(175,189,215)">0.136</td>
<td valign="top" align="char" char="." style="background-color:rgb(177,191,216)">0.133</td>
<td valign="top" align="left">ADU</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(230,234,242)">0.057</td>
<td valign="top" align="char" char="." style="background-color:rgb(231,235,243)">0.055</td>
<td valign="top" align="char" char="." style="background-color:rgb(216,223,236)">0.076</td>
<td valign="top" align="char" char="." style="background-color:rgb(240,243,248)">0.042</td>
<td valign="top" align="char" char="." style="background-color:rgb(221,227,238)">0.069</td>
<td valign="top" align="char" char="." style="background-color:rgb(212,220,234)">0.081</td>
<td valign="top" align="char" char="." style="background-color:rgb(222,228,239)">0.067</td>
<td valign="top" align="char" char="." style="background-color:rgb(143,162,198)">0.182</td>
<td valign="top" align="char" char="." style="background-color:rgb(177,191,216)">0.132</td>
<td valign="top" align="char" char="." style="background-color:rgb(180,193,217)">0.129</td>
<td valign="top" align="left">ASA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(208,217,232)">0.087</td>
<td valign="top" align="char" char="." style="background-color:rgb(157,174,205)">0.162</td>
<td valign="top" align="char" char="." style="background-color:rgb(200,210,227)">0.099</td>
<td valign="top" align="char" char="." style="background-color:rgb(183,196,219)">0.124</td>
<td valign="top" align="char" char="." style="background-color:rgb(191,202,223)">0.113</td>
<td valign="top" align="char" char="." style="background-color:rgb(199,209,227)">0.101</td>
<td valign="top" align="char" char="." style="background-color:rgb(90,119,172)">0.257</td>
<td valign="top" align="char" char="." style="background-color:rgb(146,165,200)">0.177</td>
<td valign="top" align="char" char="." style="background-color:rgb(150,168,202)">0.172</td>
<td valign="top" align="left">OLI</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(181,194,218)">0.126</td>
<td valign="top" align="char" char="." style="background-color:rgb(206,214,230)">0.091</td>
<td valign="top" align="char" char="." style="background-color:rgb(194,205,224)">0.108</td>
<td valign="top" align="char" char="." style="background-color:rgb(191,202,223)">0.113</td>
<td valign="top" align="char" char="." style="background-color:rgb(197,207,226)">0.103</td>
<td valign="top" align="char" char="." style="background-color:rgb(104,130,179)">0.237</td>
<td valign="top" align="char" char="." style="background-color:rgb(150,168,202)">0.171</td>
<td valign="top" align="char" char="." style="background-color:rgb(152,170,203)">0.168</td>
<td valign="top" align="left">BRI</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(147,166,200)">0.176</td>
<td valign="top" align="char" char="." style="background-color:rgb(157,174,206)">0.161</td>
<td valign="top" align="char" char="." style="background-color:rgb(181,194,218)">0.127</td>
<td valign="top" align="char" char="." style="background-color:rgb(188,199,221)">0.117</td>
<td valign="top" align="char" char="." style="background-color:rgb(48,84,150)">0.317</td>
<td valign="top" align="char" char="." style="background-color:rgb(119,143,186)">0.216</td>
<td valign="top" align="char" char="." style="background-color:rgb(124,147,189)">0.208</td>
<td valign="top" align="left">ANH</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(190,201,222)">0.114</td>
<td valign="top" align="char" char="." style="background-color:rgb(195,206,225)">0.106</td>
<td valign="top" align="char" char="." style="background-color:rgb(208,216,231)">0.088</td>
<td valign="top" align="char" char="." style="background-color:rgb(93,121,173)">0.253</td>
<td valign="top" align="char" char="." style="background-color:rgb(148,167,201)">0.173</td>
<td valign="top" align="char" char="." style="background-color:rgb(153,171,204)">0.166</td>
<td valign="top" align="left">RPB</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(241,244,248)">0.04</td>
<td valign="top" align="char" char="." style="background-color:rgb(233,237,244)">0.052</td>
<td valign="top" align="char" char="." style="background-color:rgb(121,145,187)">0.212</td>
<td valign="top" align="char" char="." style="background-color:rgb(166,182,210)">0.148</td>
<td valign="top" align="char" char="." style="background-color:rgb(168,183,211)">0.145</td>
<td valign="top" align="left">BBR</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(224,230,240)">0.065</td>
<td valign="top" align="char" char="." style="background-color:rgb(130,152,192)">0.199</td>
<td valign="top" align="char" char="." style="background-color:rgb(168,183,211)">0.145</td>
<td valign="top" align="char" char="." style="background-color:rgb(170,185,212)">0.143</td>
<td valign="top" align="left">ORO</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td colspan="2" valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(140,160,197)">0.186</td>
<td valign="top" align="char" char="." style="background-color:rgb(176,190,215)">0.134</td>
<td valign="top" align="char" char="." style="background-color:rgb(177,191,216)">0.133</td>
<td valign="top" align="left">DSL</td>
</tr>
<tr>
<td valign="top" align="left" scope="row"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="left"/>
<td valign="top" align="char" char="." style="background-color:rgb(153,171,204)">0.167</td>
<td valign="top" align="char" char="." style="background-color:rgb(153,170,203)">0.168</td>
<td valign="top" align="left">CHO</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="left" style="border-bottom: solid 0.50pt"/>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt; background-color:rgb(239,242,247)">0.043</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">MDN</td>
</tr>
</tbody></table></table-wrap>
</sec>
<sec>
<title>Genetic Diversity</title>
<p>Genetic diversity (expected heterozygosity [H<sub>e</sub>]) for the sampled <italic>howellii</italic> occurrences ranged from 0.094&#x00B1;0.003 standard error (SE) to 0.113&#x00B1;0.003 SE (<xref ref-type="table" rid="tB.1">table B1</xref>). The three ADNWR occurrences had similar H<sub>e</sub> and were significantly higher than the remaining three occurrences; Browns Island, Brannan Island, and Oakley (p&lt;0.001). Of the additional <italic>howellii</italic> collections, the RBG samples had a diversity estimate similar to the non-ADNWR occurrences (0.093) but the samples from ANH were much lower at 0.058. Genetic diversity estimates for clade X and <italic>cognata</italic> occurrences were all above 0.1 with the exception of Corral Hollow (0.07&#x00B1;0.003 SE). Inbreeding estimates (F<sub>IS</sub>) were essentially zero for all occurrences in the dataset (<xref ref-type="table" rid="tB.1">table B1</xref>).</p>
<p>When samples were considered by genetic cluster, rather than by occurrence (excluding samples from RBG and ANH because of unknown cultivation history), H<sub>e</sub> for <italic>cognata</italic> was significantly greater than clade X (p&lt;0.033) and <italic>howellii</italic> (p&lt;0.037) and clade X was significantly greater than <italic>howellii</italic> (p&lt;0.024). The number of private alleles found for each type was 351 (<italic>howellii</italic>), 328 (clade X), and 795 (<italic>cognata</italic>). These combined results indicated that <italic>cognata</italic> is more genetically diverse than <italic>howellii</italic> and clade X, and clade X is more genetically diverse than <italic>howellii</italic>.</p>
</sec>
<sec>
<title>Potential Hybrids</title>
<p>The snapclust hybrid model converged with no evidence of F1 or backcrossed hybrids at any location. Group membership probabilities for the three hybrid classes (F1, <italic>howellii-</italic>backcross, <italic>cognata-</italic>backcross) were statistically zero across the dataset, and all clade X samples were assigned to the <italic>howellii</italic> group (appendix B2). The maximum likelihood phylogenetic analysis strongly supported four clades, with <italic>howellii</italic> and clade X most closely related to each other and two clades within <italic>cognata</italic> that separated the two geographic locations sampled (<xref ref-type="fig" rid="figB.5">fig. B5</xref>). There were no other well-supported clades within any of these lineages that corresponded with sampling sites within clades (appendix B3). These results, in addition to the population structure results, indicated that clade X is likely a separate distinct group from <italic>howelli</italic> and <italic>cognata</italic> with no indication of modern gene flow among these clades. However, we did find high genetic similarity and evidence of recent gene exchange or origin among occurrences <italic>within howellii</italic> and within clade X. Although the intermediate morphological features of clade X could indicate that this lineage was of hybrid origin, the genetic structure suggests it has since been isolated from each parental lineage for some time. Alternatively, a common ancestor of <italic>howellii</italic> and clade X could have first diverged from <italic>cognata</italic> and then <italic>howellii</italic> and clade X further diverged from each other.</p>
<fig id="figB.5" position="float" fig-type="figure"><label>Figure B5</label><caption><p>Maximum likelihood tree collapsed at nodes with high bootstrap support. All morphologically distinguishable taxa form highly supported unique clades (clade X, <italic>howellii</italic>, and <italic>cognata</italic>). Support also was high separating the two distinct geographic populations that were sampled within <italic>cognata</italic> (Monvero Dunes and Corral Hollow). Because these occurrences are at opposite ends of the known <italic>cognata</italic> range, these differences could represent clinal variation within this taxon.</p><p content-type="toc">B5. Diagram showing maximum likelihood tree collapsed at nodes with high bootstrap support</p></caption>
<long-desc>B5. Black and white diagram showing maximum likelihood tree collapsed at nodes with high bootstrap support.</long-desc><graphic xlink:href="sac21-4141_figB.5"/></fig>
<p>Given these well-defined genetic clusters and the need for genetic identification in future taxonomic investigations, we used a discriminant analysis of principal components (DAPC; <xref ref-type="fig" rid="figB.6">fig. B6</xref>) to identify the alleles with the highest contribution to the differences between each group. We found 22 SNPs that defined discriminant axis (DA) 1, and 5 SNPs on DA 2. DA 1 differentiated <italic>cognata</italic> from remaining samples, and DA 2 differentiated clade X from <italic>howellii</italic>. The list of SNPs and the original 95bp locus sequences are included in appendix B4.</p>
<fig id="figB.6" position="float" fig-type="figure"><label>Figure B6</label><caption><p>Discriminant analysis of principal components (DAPC) plot maximizing differences between genetic clusters (red, <italic>howellii</italic>; purple, clade X; green, <italic>cognata</italic>). Inset shows proportion of principal components retained in analysis.</p><p content-type="toc">B6. Discriminant analysis of principal components plot showing maximizing differences among genetic clusters</p></caption>
<long-desc>B6. Colored discriminant analysis of principal components plot maximizing differences among genetic clusters (red, howellii; purple, clade X; green, cognata). Inset shows proportion of principal components retained in analysis</long-desc><graphic xlink:href="sac21-4141_figB.6"/></fig>
</sec>
</sec>
<sec>
<title>Discussion</title>
<p>We found evidence of two distinct genetic clusters on the Antioch sand sheet, supporting that there are two taxa present with distinctive morphological and genetic features; <italic>howellii</italic> and clade X. Within <italic>howellii</italic>, genetic diversity was lowest for the smaller <italic>howellii</italic> occurrences, and higher for the ANDWR occurrences, which is consistent with reported out-plantings at Browns and Brannan Islands that used plant material sourced from ANDWR (<xref ref-type="bibr" rid="r-3-24">U.S. Fish and Wildlife Service, 2008</xref>). If there is a future need to manage or restore Browns and Brannan Islands occurrences, sourcing materials from ANDWR could help to boost genetic diversity in these occurrences. The Oakley location is the only natural <italic>howellii</italic> occurrence without a known origin of source material from ANDWR, and though it is clearly <italic>howellii</italic>, it was found to be more genetically distant from the ANDWR and ANDWR-derived occurrences. This occurrence was relatively small, with only four adult plants detected at the time of survey, although juvenile plants suggest some recruitment. The small sample from Annie&#x2019;s Nursery appears to be most genetically distant from the non-cultivated <italic>howellii</italic> occurrences. The natural source of these plants and the number of generations in cultivation are unknown and likely contribute to this relative distinctiveness. As such, these plants do not appear to be an important source of diversity relevant to the existing natural and out-planted occurrences.</p>
<p>The remaining three sampled locations on the Antioch sand sheet exclusively contained individuals of the morphologically distinctive clade X. All of our population and phylogenetic analyses indicated that this clade appears to be more closely related to <italic>howellii</italic> than to <italic>cognata</italic> and that it does not show evidence of recent hybridization or gene flow with either <italic>howellii</italic> or <italic>cognata</italic>. Notably, no surveyed occurrences contained more than one clade. Even the two closest occurrences (Oakley legless lizard population of <italic>howellii</italic> and the Big Break clade X population), which are less than 1 kilometer apart, showed no mixed assignment. Although clade X may be of hybrid origin, it is possible that a genome structural mutation or non-Mendelian pattern of inheritance resulted in incompatibility between lineages. Chromosomal rearrangements and permanent translocation heterozygosity are well documented in the genus <italic>Oenothera</italic> (<xref ref-type="bibr" rid="r-3-12">Holsinger and Ellstrand, 1984</xref>; <xref ref-type="bibr" rid="r-3-14">Johnson, 2011</xref>). Because there is no evidence of recent hybridization, potential hybridization between <italic>howellii</italic> and clade X is likely not a threat to extant <italic>howellii</italic> occurrences, although morphological traits of plants in extant <italic>howellii</italic> occurrences could be periodically monitored to detect any range changes in <italic>howellii</italic> and clade X.</p>
<p>Regardless of origin, clade X could represent new, previously undescribed diversity in the <italic>O. deltoides</italic> lineage that could benefit from protection given that it appears to have a limited range. To further resolve the taxonomic status of the unidentified clade, we suggest a two-pronged approach. The first step is conducting more in-depth morphological and phylogenetic analyses on the entire <italic>O. deltoides</italic> species complex. Some of the identifying morphological traits in this clade appear to be plastic; therefore, careful analysis of these particular traits in sister taxa may clarify the use of those traits as defining characteristics. An expanded phylogenetic analysis of the entire species complex with nuclear markers and increased marker density could better resolve the relationships between taxa and confirm the placement of clade X. The original phylogeny of <italic>Oenothera</italic>, sections Anogra and Kleinia was based on plastid gene sequences (<xref ref-type="bibr" rid="r-3-6">Evans and others, 2005</xref>, <xref ref-type="bibr" rid="r-3-7">2009</xref>), however there are known confounding interactions between nuclear and chloroplast genomes within <italic>Oenothera</italic> (<xref ref-type="bibr" rid="r-3-3">Chiu and Sears, 1993</xref>) that may affect phylogenetic interpretation. We have demonstrated that over 2,500 genomic loci can be developed by using a ddRADseq approach and identified a set of markers that can be used to distinguish these 3 independent clades. It is possible to extend this method for the <italic>O. deltoides</italic> species complex. In the second step, demographic modeling could be used to explore the age of each lineage and estimate historical population sizes and migration rates between the groups. These models can be used to test hypotheses of historical hybridization events and the evolutionary history of this group. Finally, should these additional analyses support clade X as a new <italic>Oenothera deltoides</italic> lineage, expanding surveys of the Antioch sand sheet could uncover more occurrences and extend the known range of this taxon.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgments</title>
<p>This work was supported by the U.S. Fish and Wildlife Service San Francisco Bay-Delta Fish and Wildlife, Friends of San Pablo Bay National Wildlife Refuge and Antioch Dunes National Wildlife Refuge, and the U.S. Geological Survey Western Ecological Research Center. Bioinformatic analyses were carried out on the Yeti Supercomputer: U.S. Geological Survey, <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5066/F7D798MJ">https://doi.org/10.5066/F7D798MJ</ext-link>. We acknowledge Julia Smith from the U.S. Geological Survey Western Ecological Research Center, for assistance with genetic data collection. For help with occurrence logistics or general information, we would like to thank J. de la Cruz and J. McMurray from the city of Oakley; M. Ferrell from the California Department of Water Resources; L. Terrazas, D. Brubaker, S. Euing from U.S. Fish and Wildlife Service Antioch Dunes National Wildlife Refuge ; M. Moran and R. Pulizzi from Big Break Regional Shoreline; A. Janke from city of Walnut Creek; B. O&#x2019;Brien, T. Fitanides, and B. Anderson from the Regional Parks Botanic Garden; R. O&#x2019;Dell from the Bureau of Land Management; D. Lake from East Bay California Native Plant Society ; T. Barry and E. Dean from the UC Davis Center for Plant Diversity Herbarium; the Contra Costa Water District; K. Heffernan and F. Takahashi from San Luis National Wildlife Refuge Complex; M. Hammond and C. Lare-Masters from East Bay Regional Park District; and V. Stewart from San Francisco Botanical Garden.</p>
</ack>
<ref-list>
<title>References Cited</title>
<ref id="r-3-1"><mixed-citation publication-type="book"><person-group person-group-type="editor"><string-name><surname>Baldwin</surname>, <given-names>B.G.</given-names></string-name>, <string-name><surname>Goldman</surname>, <given-names>D.</given-names></string-name>, <string-name><surname>Keil</surname>, <given-names>D.J.</given-names></string-name>, <string-name><surname>Patterson</surname>, <given-names>R.</given-names></string-name>, and <string-name><surname>Rosatti</surname>, <given-names>T.J.</given-names></string-name></person-group>, eds., <year>2012</year>, <source>The jepson manual&#x2014;Vascular plants of California</source>: <publisher-name>University of California Press</publisher-name>, <size units="page">1596</size>&#x00A0;p., <pub-id pub-id-type="doi">https://doi.org/10.1525/9780520951372</pub-id>.</mixed-citation></ref>
<ref id="r-3-2"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Catchen</surname>, <given-names>J.M.</given-names></string-name>, <string-name><surname>Amores</surname>, <given-names>A.</given-names></string-name>, <string-name><surname>Hohenlohe</surname>, <given-names>P.</given-names></string-name>, <string-name><surname>Cresko</surname>, <given-names>W.</given-names></string-name>, and <string-name><surname>Postlethwait</surname>, <given-names>J.H.</given-names></string-name></person-group>, <year>2011</year>, <article-title>Stacks&#x2014;Building and genotyping loci de novo from short-read sequences:</article-title><source> G3&#x2014;Genes, Genomes, Genetics</source>, v.&#x00A0;<volume>1</volume>, no. 3, p.&#x00A0;<fpage>171</fpage>&#x2013;<lpage>182</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1534/g3.111.000240</pub-id>.</mixed-citation></ref>
<ref id="r-3-3"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Chiu</surname>, <given-names>W.L.</given-names></string-name>, and <string-name><surname>Sears</surname>, <given-names>B.B.</given-names></string-name></person-group>, <year>1993</year>, <article-title>Plastome-genome interactions affect plastid transmission in <italic>Oenothera</italic></article-title>: <source>Genetics</source>, v.&#x00A0;<volume>133</volume>, no.&#x00A0;<issue>4</issue>, p.&#x00A0;<fpage>989</fpage>&#x2013;<lpage>997</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1093/genetics/133.4.989</pub-id>.</mixed-citation></ref>
<ref id="r-3-4"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Cleland</surname>, <given-names>R.E.</given-names></string-name></person-group>, <year>1972</year>, <source><italic>Oenothera</italic>; Cytogenetics and Evolution</source>: <publisher-loc>London, New York</publisher-loc>, <publisher-name>Academic Press</publisher-name>.</mixed-citation></ref>
<ref id="r-3-5"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Engelhardt</surname>, <given-names>K.A.M.</given-names></string-name>, <string-name><surname>Lloyd</surname>, <given-names>M.W.</given-names></string-name>, and <string-name><surname>Neel</surname>, <given-names>M.C.</given-names></string-name></person-group>, <year>2014</year>, <article-title>Effects of genetic diversity on conservation and restoration potential at individual, population, and regional scales</article-title>: <source>Biological Conservation</source>, v.&#x00A0;<volume>179</volume>, p.&#x00A0;<fpage>6</fpage>&#x2013;<lpage>16</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1016/j.biocon.2014.08.011</pub-id>.</mixed-citation></ref>
<ref id="r-3-6"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Evans</surname>, <given-names>M.E.K.</given-names></string-name>, <string-name><surname>Hearn</surname>, <given-names>D.J.</given-names></string-name>, <string-name><surname>Hahn</surname>, <given-names>W.J.</given-names></string-name>, <string-name><surname>Spangle</surname>, <given-names>J.M.</given-names></string-name>, and <string-name><surname>Venable</surname>, <given-names>D.L.</given-names></string-name></person-group>, <year>2005</year>, <article-title>Climate and life-history evolution in evening primroses (<italic>Oenothera</italic>, Onagraceae)&#x2014;A phylogenetic comparative analysis</article-title>: <source>Evolution; International Journal of Organic Evolution</source>, v.&#x00A0;<volume>59</volume>, no.&#x00A0;<issue>9</issue>, p.&#x00A0;<fpage>1914</fpage>&#x2013;<lpage>1927</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1111/j.0014-3820.2005.tb01061.x</pub-id>.</mixed-citation></ref>
<ref id="r-3-7"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Evans</surname>, <given-names>M.E.K.</given-names></string-name>, <string-name><surname>Smith</surname>, <given-names>S.A.</given-names></string-name>, <string-name><surname>Flynn</surname>, <given-names>R.S.</given-names></string-name>, and <string-name><surname>Donoghue</surname>, <given-names>M.J.</given-names></string-name></person-group>, <year>2009</year>, <article-title>Climate, niche evolution, and diversification of the &#x201C;bird&#x2010;cage&#x201D; evening primroses (<italic>Oenothera</italic>, Sections <italic>Anogra</italic> and <italic>Kleinia</italic>)</article-title>: <source>American Naturalist</source>, v.&#x00A0;<volume>173</volume>, no.&#x00A0;<issue>2</issue>, p.&#x00A0;<fpage>225</fpage>&#x2013;<lpage>240</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1086/595757</pub-id>.</mixed-citation></ref>
<ref id="r-3-8"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Frankham</surname>, <given-names>R.</given-names></string-name>, <string-name><surname>Ballou</surname>, <given-names>J.D.</given-names></string-name>, <string-name><surname>Ralls</surname>, <given-names>K.</given-names></string-name>, <string-name><surname>Eldridge</surname>, <given-names>M.D.B.</given-names></string-name>, <string-name><surname>Dudash</surname>, <given-names>M.R.</given-names></string-name>, <string-name><surname>Fenster</surname>, <given-names>C.B.</given-names></string-name>, <string-name><surname>Lacy</surname>, <given-names>R.C.</given-names></string-name>, and <string-name><surname>Sunnucks</surname>, <given-names>P.</given-names></string-name></person-group>, <year>2017</year>, <source>Genetic management of fragmented animal and plant populations</source>: <publisher-loc>Oxford</publisher-loc>, <publisher-name>Oxford University Press</publisher-name>, <size units="page">401</size>&#x00A0;p., <pub-id pub-id-type="doi">https://doi.org/10.1093/oso/9780198783398.001.0001</pub-id>.</mixed-citation></ref>
<ref id="r-3-9"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Golczyk</surname>, <given-names>H.</given-names></string-name>, <string-name><surname>Massouh</surname>, <given-names>A.</given-names></string-name>, and <string-name><surname>Greiner</surname>, <given-names>S.</given-names></string-name></person-group>, <year>2014</year>, <article-title>Translocations of chromosome end-segments and facultative heterochromatin promote meiotic ring formation in evening primroses</article-title>: <source>The Plant Cell</source>, v.&#x00A0;<volume>26</volume>, no.&#x00A0;<issue>3</issue>, p.&#x00A0;<fpage>1280</fpage>&#x2013;<lpage>1293</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1105/tpc.114.122655</pub-id>.</mixed-citation></ref>
<ref id="r-3-10"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Golczyk</surname>, <given-names>H.</given-names></string-name>, <string-name><surname>Musia&#x0142;</surname>, <given-names>K.</given-names></string-name>, <string-name><surname>Rauwolf</surname>, <given-names>U.</given-names></string-name>, <string-name><surname>Meurer</surname>, <given-names>J.</given-names></string-name>, <string-name><surname>Herrmann</surname>, <given-names>R.G.</given-names></string-name>, and <string-name><surname>Greiner</surname>, <given-names>S.</given-names></string-name></person-group>, <year>2008</year>, <article-title>Meiotic events in <italic>Oenothera</italic>&#x2014;A non-standard pattern of chromosome behaviour</article-title>: <source>Genome</source>, v.&#x00A0;<volume>51</volume>, no.&#x00A0;<issue>11</issue>, p.&#x00A0;<fpage>952</fpage>&#x2013;<lpage>958</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1139/G08-081</pub-id>.</mixed-citation></ref>
<ref id="r-3-11"><mixed-citation publication-type="book"><person-group person-group-type="author"><string-name><surname>Greene</surname>, <given-names>J.A.</given-names></string-name></person-group>, <year>1995</year>, <source>Three reproductive ecology studies in the narrow endemic <italic>Oenothera deltoides</italic> ssp. <italic>howellii</italic> (Onagraceae)</source>: <publisher-loc>Claremont, CA</publisher-loc>, <publisher-name>Claremont Graduate University</publisher-name>, <size units="page">39</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-3-12"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Holsinger</surname>, <given-names>K.E.</given-names></string-name>, and <string-name><surname>Ellstrand</surname>, <given-names>N.C.</given-names></string-name></person-group>, <year>1984</year>, <article-title>The evolution and ecology of permanent translocation heterozygotes</article-title>: <source>American Naturalist</source>, v.&#x00A0;<volume>124</volume>, no.&#x00A0;<issue>1</issue>, p.&#x00A0;<fpage>48</fpage>&#x2013;<lpage>71</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1086/284251</pub-id>.</mixed-citation></ref>
<ref id="r-3-13"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Hughes</surname>, <given-names>A.R.</given-names></string-name>, <string-name><surname>Inouye</surname>, <given-names>B.D.</given-names></string-name>, <string-name><surname>Johnson</surname>, <given-names>M.T.J.</given-names></string-name>, <string-name><surname>Underwood</surname>, <given-names>N.</given-names></string-name>, and <string-name><surname>Vellend</surname>, <given-names>M.</given-names></string-name></person-group>, <year>2008</year>, <article-title>Ecological consequences of genetic diversity</article-title>: <source>Ecology Letters</source>, v.&#x00A0;<volume>11</volume>, no.&#x00A0;<issue>6</issue>, p.&#x00A0;<fpage>609</fpage>&#x2013;<lpage>623</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1111/j.1461-0248.2008.01179.x</pub-id>.</mixed-citation></ref>
<ref id="r-3-14"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Johnson</surname>, <given-names>M.T.J.</given-names></string-name></person-group>, <year>2011</year>, <article-title>The contribution of evening primrose (<italic>Oenothera biennis</italic>) to a modern synthesis of evolutionary ecology</article-title>: <source>Population Ecology</source>, v.&#x00A0;<volume>53</volume>, no.&#x00A0;<issue>1</issue>, p.&#x00A0;<fpage>9</fpage>&#x2013;<lpage>21</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1007/s10144-010-0250-5</pub-id>.</mixed-citation></ref>
<ref id="r-3-15"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Jombart</surname>, <given-names>T.</given-names></string-name></person-group>, <year>2008</year>, <article-title>adegenet&#x2014;A R package for the multivariate analysis of genetic markers</article-title>: <source>Bioinformatics (Oxford, England)</source>, v.&#x00A0;<volume>24</volume>, no.&#x00A0;<issue>11</issue>, p.&#x00A0;<fpage>1403</fpage>&#x2013;<lpage>1405</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1093/bioinformatics/btn129</pub-id>.</mixed-citation></ref>
<ref id="r-3-16"><mixed-citation publication-type="other">Klein, W., 1962, New taxa and recombinations in <italic>Oenothera</italic> (Anogra): Aliso&#x2014;A Journal of Systematic and Evolutionary Botany, v. 5, no. 2, p. 179&#x2013;180.</mixed-citation></ref>
<ref id="r-3-17"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Klein</surname>, <given-names>W.M.</given-names></string-name></person-group>, <year>1970</year>, <article-title>The evolution of three diploid species of <italic>Oenothera</italic> Subgenus <italic>Anogra</italic> (Onagraceae)</article-title>: <source>Evolution; International Journal of Organic Evolution</source>, v.&#x00A0;<volume>24</volume>, no.&#x00A0;<issue>3</issue>, p.&#x00A0;<fpage>578</fpage>&#x2013;<lpage>597</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1111/j.1558-5646.1970.tb01793.x</pub-id>.</mixed-citation></ref>
<ref id="r-3-18"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Munz</surname>, <given-names>P.</given-names></string-name></person-group>, <year>1949</year>, <article-title>California miscellany-I</article-title>: <source>Aliso</source>, v.&#x00A0;<volume>2</volume>, no.&#x00A0;<issue>1</issue>, p.&#x00A0;<fpage>77</fpage>&#x2013;<lpage>86</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.5642/aliso.19490201.05</pub-id>.</mixed-citation></ref>
<ref id="r-3-19"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Paris</surname>, <given-names>J.R.</given-names></string-name>, <string-name><surname>Stevens</surname>, <given-names>J.R.</given-names></string-name>, and <string-name><surname>Catchen</surname>, <given-names>J.M.</given-names></string-name></person-group>, <year>2017</year>, <article-title>Lost in parameter space&#x2014;A road map for stacks</article-title>: <source>Methods in Ecology and Evolution</source>, v.&#x00A0;<volume>8</volume>, no.&#x00A0;<issue>10</issue>, p.&#x00A0;<fpage>1360</fpage>&#x2013;<lpage>1373</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1111/2041-210X.12775</pub-id>.</mixed-citation></ref>
<ref id="r-3-20"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Peterson</surname>, <given-names>B.K.</given-names></string-name>, <string-name><surname>Weber</surname>, <given-names>J.N.</given-names></string-name>, <string-name><surname>Kay</surname>, <given-names>E.H.</given-names></string-name>, <string-name><surname>Fisher</surname>, <given-names>H.S.</given-names></string-name>, and <string-name><surname>Hoekstra</surname>, <given-names>H.E.</given-names></string-name></person-group>, <year>2012</year>, Double digest RADseq&#x2014;An inexpensive method for de novo SNP discovery and genotyping in model and non-model species: PLoS One, v. 7, no. 5, 11 p., <pub-id pub-id-type="doi">https://doi.org/10.1371/journal.pone.0037135</pub-id>.</mixed-citation></ref>
<ref id="r-3-21"><mixed-citation publication-type="web">R Core Team, 2016, R&#x2014;A language and environment for statistical computing, ver. 3.2.2: R Foundation for Statistical Computing software release, <ext-link ext-link-type="uri" xlink:href="https://www.R-project.org/">https://www.R-project.org/</ext-link>.</mixed-citation></ref>
<ref id="r-3-22"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Raj</surname>, <given-names>A.</given-names></string-name>, <string-name><surname>Stephens</surname>, <given-names>M.</given-names></string-name>, and <string-name><surname>Pritchard</surname>, <given-names>J.K.</given-names></string-name></person-group>, <year>2014</year>, <article-title>fastSTRUCTURE&#x2014;Variational inference of population structure in large SNP data sets</article-title>: <source>Genetics</source>, v.&#x00A0;<volume>197</volume>, no.&#x00A0;<issue>2</issue>, p.&#x00A0;<fpage>573</fpage>&#x2013;<lpage>589</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1534/genetics.114.164350</pub-id>.</mixed-citation></ref>
<ref id="r-3-23"><mixed-citation publication-type="journal"><person-group person-group-type="author"><string-name><surname>Stamatakis</surname>, <given-names>A.</given-names></string-name></person-group>, <year>2014</year>, <article-title>RAxML version 8&#x2014;A tool for phylogenetic analysis and post-analysis of large phylogenies</article-title>: <source>Bioinformatics (Oxford, England)</source>, v.&#x00A0;<volume>30</volume>, no.&#x00A0;<issue>9</issue>, p.&#x00A0;<fpage>1312</fpage>&#x2013;<lpage>1313</lpage>, <pub-id pub-id-type="doi">https://doi.org/10.1093/bioinformatics/btu033</pub-id>.</mixed-citation></ref>
<ref id="r-3-24"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>2008</year>, <source>Lange&#x2019;s metalmark butterfly, Antioch Dunes evening-primrose, and Contra Costa wallflower 5-year review&#x2014;Summary and evaluation</source>: <publisher-loc>Sacramento, Calif.</publisher-loc>, <publisher-name>U.S. Fish and Wildlife Service</publisher-name>, <size units="page">37</size>&#x00A0;p.</mixed-citation></ref>
<ref id="r-3-25"><mixed-citation publication-type="book"><person-group person-group-type="author"><collab>U.S. Fish and Wildlife Service</collab></person-group>, <year>2020</year>, <source>Five year review for the Antioch Dunes evening-primrose (<italic>Oenothera deltoides</italic> subsp. <italic>howellii</italic>)</source>: <publisher-loc>Sacramento, Calif.</publisher-loc>, <publisher-name>Sacramento Fish and Wildlife Office</publisher-name>, <size units="page">21</size>&#x00A0;p.</mixed-citation></ref>
</ref-list>
<app>
<title>Appendix B1.&#x2003;Supplemental Principal Component Analysis Plot</title>

<p>PC3 describes the variation between <italic>cognata</italic> sampling locations Corral Hollow in the north and both Monvero Dunes locations in the south. (<xref ref-type="fig" rid="figB1.1">fig. B1.1</xref>).</p>
<fig id="figB1.1" position="float" fig-type="figure"><label>Figure B1.1</label><caption><p>Principal component analysis plot of PC1 and PC3 where each point represents an individual, each ellipse represents a sampling location, and color indicates type (red, <italic>howellii</italic>; purple, clade X; green, <italic>cognata</italic>). Eigenvalue inset shows relative proportion of variation explained by each principal component (PC) axis.</p></caption>
<long-desc>B1.1.</long-desc><graphic xlink:href="sac21-4141_figB1.1"/></fig>

</app>
<app>
<title>Appendix B2.&#x2003;Snapclust Hybrid Test Results</title>

<table-wrap id="tB2.1" position="float">
<label>Table B2.1</label><caption><title>Group membership probabilities by sample, available at <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3133/ofr20211017">https://doi.org/10.3133/ofr20211017</ext-link>.</title>
</caption>
<table rules="groups"><tbody>
<tr>
<td/>
</tr>
</tbody>
</table>
</table-wrap>

</app>
<app>
<title>Appendix B3.&#x2003;Maximum Likelihood Tree</title>

<fig id="figB3.1" position="float" fig-type="figure"><label>Figure B3.1</label><caption><p>Full maximum likelihood tree with bootstrap support values at nodes.</p></caption>
<long-desc>B3.1.</long-desc><graphic xlink:href="sac21-4141_figB3.1"/></fig>

</app>
<app>
<title>Appendix B4.&#x2003; Discriminate Analysis of Principal Components Results</title>

<table-wrap id="tB4.1" position="float">
<label>Table B4.1</label><caption><title>Allele frequencies for discriminate analysis of principal components informative loci.</title>
<p>[DA, discriminate axis; SNP, single nucleotide polymorphism. <italic>Allele</italic>: A, adenine; T, thymine; C, cytosine; G, guanine]</p>
</caption>
<table rules="groups">
<col width="9.96%"/>
<col width="9.08%"/>
<col width="14.53%"/>
<col width="7.68%"/>
<col width="19.54%"/>
<col width="19.54%"/>
<col width="19.67%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">DA Axis</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Locus</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">SNP position</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Allele</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt"><italic>howellii</italic> frequency</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">clade X frequency</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt"><italic>cognata</italic> frequency</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt" scope="row">1</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">1675</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">17</td>
<td valign="top" align="center" style="border-top: solid 0.50pt">C</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">1</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">1</td>
<td valign="top" align="char" char="." style="border-top: solid 0.50pt">0.5</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">1675</td>
<td valign="top" align="char" char=".">17</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.5</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">5951</td>
<td valign="top" align="char" char=".">81</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.87295082</td>
<td valign="top" align="char" char=".">0.837209302</td>
<td valign="top" align="char" char=".">0.075</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">5951</td>
<td valign="top" align="char" char=".">81</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.12704918</td>
<td valign="top" align="char" char=".">0.162790698</td>
<td valign="top" align="char" char=".">0.925</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">8298</td>
<td valign="top" align="char" char=".">36</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.813559322</td>
<td valign="top" align="char" char=".">0.837209302</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">8298</td>
<td valign="top" align="char" char=".">36</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.186440678</td>
<td valign="top" align="char" char=".">0.162790698</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">11136</td>
<td valign="top" align="char" char=".">40</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.71875</td>
<td valign="top" align="char" char=".">0.083333333</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">11136</td>
<td valign="top" align="char" char=".">40</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.28125</td>
<td valign="top" align="char" char=".">0.916666667</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">14084</td>
<td valign="top" align="char" char=".">19</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.372881356</td>
<td valign="top" align="char" char=".">0.941860465</td>
<td valign="top" align="char" char=".">0.960526316</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">14084</td>
<td valign="top" align="char" char=".">19</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.627118644</td>
<td valign="top" align="char" char=".">0.058139535</td>
<td valign="top" align="char" char=".">0.039473684</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">15139</td>
<td valign="top" align="char" char=".">35</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.984042553</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.6</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">15139</td>
<td valign="top" align="char" char=".">35</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.015957447</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.4</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">16696</td>
<td valign="top" align="char" char=".">63</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.808695652</td>
<td valign="top" align="char" char=".">0.6125</td>
<td valign="top" align="char" char=".">0.138888889</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">16696</td>
<td valign="top" align="char" char=".">63</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.191304348</td>
<td valign="top" align="char" char=".">0.3875</td>
<td valign="top" align="char" char=".">0.861111111</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">18527</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.803921569</td>
<td valign="top" align="char" char=".">0.042857143</td>
<td valign="top" align="char" char=".">0.283783784</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">18527</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.196078431</td>
<td valign="top" align="char" char=".">0.957142857</td>
<td valign="top" align="char" char=".">0.716216216</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">24555</td>
<td valign="top" align="char" char=".">73</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.454545455</td>
<td valign="top" align="char" char=".">0.078947368</td>
<td valign="top" align="char" char=".">0.944444444</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">24555</td>
<td valign="top" align="char" char=".">73</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.545454545</td>
<td valign="top" align="char" char=".">0.921052632</td>
<td valign="top" align="char" char=".">0.055555556</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">24703</td>
<td valign="top" align="char" char=".">48</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.873786408</td>
<td valign="top" align="char" char=".">0.073170732</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">24703</td>
<td valign="top" align="char" char=".">48</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.126213592</td>
<td valign="top" align="char" char=".">0.926829268</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">25273</td>
<td valign="top" align="char" char=".">69</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.026315789</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">25273</td>
<td valign="top" align="char" char=".">69</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.973684211</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">26807</td>
<td valign="top" align="char" char=".">58</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.690217391</td>
<td valign="top" align="char" char=".">0.716666667</td>
<td valign="top" align="char" char=".">0.042857143</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">26807</td>
<td valign="top" align="char" char=".">58</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.309782609</td>
<td valign="top" align="char" char=".">0.283333333</td>
<td valign="top" align="char" char=".">0.957142857</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">30501</td>
<td valign="top" align="char" char=".">93</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.938596491</td>
<td valign="top" align="char" char=".">0.56097561</td>
<td valign="top" align="char" char=".">0.054054054</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">30501</td>
<td valign="top" align="char" char=".">93</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.061403509</td>
<td valign="top" align="char" char=".">0.43902439</td>
<td valign="top" align="char" char=".">0.945945946</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">33198</td>
<td valign="top" align="char" char=".">82</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.157142857</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">33198</td>
<td valign="top" align="char" char=".">82</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.842857143</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">34130</td>
<td valign="top" align="char" char=".">19</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.5</td>
<td valign="top" align="char" char=".">0.329545455</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">34130</td>
<td valign="top" align="char" char=".">19</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.5</td>
<td valign="top" align="char" char=".">0.670454545</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">34986</td>
<td valign="top" align="char" char=".">41</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.7625</td>
<td valign="top" align="char" char=".">0.090909091</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">34986</td>
<td valign="top" align="char" char=".">41</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.2375</td>
<td valign="top" align="char" char=".">0.909090909</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">42124</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.668032787</td>
<td valign="top" align="char" char=".">0.321428571</td>
<td valign="top" align="char" char=".">0.325</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">2</td>
<td valign="top" align="char" char=".">42124</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.331967213</td>
<td valign="top" align="char" char=".">0.678571429</td>
<td valign="top" align="char" char=".">0.675</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">42661</td>
<td valign="top" align="char" char=".">85</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.867768595</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.225</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">42661</td>
<td valign="top" align="char" char=".">85</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.132231405</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.775</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">44259</td>
<td valign="top" align="char" char=".">11</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.431623932</td>
<td valign="top" align="char" char=".">0.686046512</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">44259</td>
<td valign="top" align="char" char=".">11</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.568376068</td>
<td valign="top" align="char" char=".">0.313953488</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">47505</td>
<td valign="top" align="char" char=".">46</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">0.967213115</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">47505</td>
<td valign="top" align="char" char=".">46</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.032786885</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">52208</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.577669903</td>
<td valign="top" align="char" char=".">0.931034483</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">52208</td>
<td valign="top" align="char" char=".">14</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.422330097</td>
<td valign="top" align="char" char=".">0.068965517</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">53441</td>
<td valign="top" align="char" char=".">45</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.487179487</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">53441</td>
<td valign="top" align="char" char=".">45</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.512820513</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">53792</td>
<td valign="top" align="char" char=".">57</td>
<td valign="top" align="center">A</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.462962963</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">53792</td>
<td valign="top" align="char" char=".">57</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.537037037</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">54384</td>
<td valign="top" align="char" char=".">72</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.15625</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">54384</td>
<td valign="top" align="char" char=".">72</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.84375</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">62956</td>
<td valign="top" align="char" char=".">23</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0.371794872</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">62956</td>
<td valign="top" align="char" char=".">23</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">0.628205128</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">63998</td>
<td valign="top" align="char" char=".">88</td>
<td valign="top" align="center">C</td>
<td valign="top" align="char" char=".">0.99047619</td>
<td valign="top" align="char" char=".">1</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">63998</td>
<td valign="top" align="char" char=".">88</td>
<td valign="top" align="center">T</td>
<td valign="top" align="char" char=".">0.00952381</td>
<td valign="top" align="char" char=".">0</td>
<td valign="top" align="char" char=".">1</td>
</tr>
<tr>
<td valign="top" align="char" char="." scope="row">1</td>
<td valign="top" align="char" char=".">68215</td>
<td valign="top" align="char" char=".">81</td>
<td valign="top" align="center">G</td>
<td valign="top" align="char" char=".">0.991150442</td>
<td valign="top" align="char" char=".">0.618421053</td>
<td valign="top" align="char" char=".">0</td>
</tr>
<tr>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt" scope="row">1</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">68215</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">81</td>
<td valign="top" align="center" style="border-bottom: solid 0.50pt">T</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">0.008849558</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">0.381578947</td>
<td valign="top" align="char" char="." style="border-bottom: solid 0.50pt">1</td>
</tr>
</tbody></table></table-wrap>
<table-wrap id="tB4.2" position="float">
<label>Table B4.2</label><caption><title>Consensus 95bp sequence for discriminate analysis of principal components informative loci.</title>
</caption>
<table rules="groups">
<col width="6.14%"/>
<col width="93.86%"/>
<thead>
<tr>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Locus</td>
<td valign="middle" align="center" scope="col" style="border-top: solid 0.50pt; border-bottom: solid 0.50pt">Sequence</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="border-top: solid 0.50pt" scope="row">1675</td>
<td valign="top" align="left" style="border-top: solid 0.50pt">AATTCGTCGGAGCGCGCGATTCTTTCAGGCCATCCGGCGGCAAAACGGCGACTCTTGAGGCTTCCGGACCAGCTATTGGGGTTTCGCGAAGTTTC</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">5951</td>
<td valign="top" align="left">AATTCAAGTCTCTTCCTTGGACATGAACTGTCAAACAACTGCAGAAGAAGACAAGGCATGTTTTAGCAGTAAGAGGGTTTGTCTTGGACATATTT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">8298</td>
<td valign="top" align="left">AATTCTCAAGTCCAACAAAGGTTCCTTCATGGCATAAAAAATCTCTCCTACCTATCAAAGCAGGAGATGACATCTACTTGTATAATAATTCTATT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">15139</td>
<td valign="top" align="left">AATTCTCTGACACCAATCACCTTTGTCAAAAGCCTTACCCCCTCTCTAAGAATGAATGTTTGAACCAAACTTCAAAAAATCCCTCTCTTTTTTAT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">16696</td>
<td valign="top" align="left">AATTCCTTACTTCTCAGAAATGCTTGCTTCAAATCAAAGAAAGAAGATCCATTATTCCACGTACTTGGCAGGTTAGCGACAGAAAATCCCCATCA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">24555</td>
<td valign="top" align="left">AATTCCCTTCTTCTCCATGACTATTCGTGCCAATTCTTCCACGCTGCTATTTTGATTTCTGTATCAAAATGCAAAATTGAATGGAATAACCAATA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">25273</td>
<td valign="top" align="left">AATTCAGAAAATAATAAATGAGCTTCCTCGGAGTAGTTTCTAGTTGAGTGAAACACTGTGCCTCCTGGCTCCTGGCCTAGCCTGCTGTAAATGCA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">26807</td>
<td valign="top" align="left">AATTCTACATATCGGCAACAAGAGTTGCCTCTGAAGAGTGTCCAGTGTTCCTTTTTTCTTTTTGTTGTTTTGAAGTATTGTTTTATGTATCACAT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">30501</td>
<td valign="top" align="left">AATTCTAAGGAGGAGGCAGCAGCGCGCCAAGCTCGAGGCTCAGAACAAACTTGCAAAAGATCGCAAGGTTTCCTTTCCTATCTCTCTCGCTCACT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">33198</td>
<td valign="top" align="left">AATTCTATTCTCCGTTTACAGTGCTGAGAGAAAAAGAAAGATAATGTTTCTGACCTGAACGTCGAATTCGATGAAGTCGATTGGGAACTTGGCGG</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">34130</td>
<td valign="top" align="left">AATTCAATCGAAAGTGACAAGAATATCATACATTTGTACCATCAAATCCCATTTTAGTATCCACAGAAAATAAAAGAACTAAAATAGGAAGATTA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">34986</td>
<td valign="top" align="left">AATTCCAATTAGACCTAGGATCTGGCTGATGCGGTAGATCCTGGTGATGGAAATGATGGGTCTGACTAATAAAACTTGGGTAGCTGCGCTTTCGA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">42661</td>
<td valign="top" align="left">AATTCCTACTGAAATCGCCAACTTATATATGATTAGTAAGATTAGGAAAAGAGTCCATAATTACTACAGAAACAAAGAGTAAAATGAGATTCTTC</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">44259</td>
<td valign="top" align="left">AATTCTCCGATGATTGCCCGTTCGTGAATCTGGGTTTGAATTCTGCCGCATTCTCTGTTGATTCGTGTTTCGGTGGACCAGATTTGATTTCTGAG</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">47505</td>
<td valign="top" align="left">AATTCCGCTAACGCTTGCGCTGAATAAAACTGAACTTGTTGATGAAGAGGTTCGAACAACTTCTCAACACTATCTGCACTTAGTTCTTGAGCTAG</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">52208</td>
<td valign="top" align="left">AATTCATTTATAGGTAGAATTGGTTCACATTTTCAGGACTTTGAGGATGCGATGCAAGAGGTGCGACCCTCAGTATCGCTGAATGAACTCGGTAC</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">53441</td>
<td valign="top" align="left">AATTCAGAGGTCAATGCTGCCAAGTGTGCAAGGCCAGGAAGAAGGAAAGTGGGTTGTGGTTGATTCAGGTCTGTGCTCTTCCATCCATTTGGCTA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">53792</td>
<td valign="top" align="left">AATTCTATGATTCTTTACAGGAACTATAGGGAAGAAAGACCATTTTACACGAACATATCATATATTTACAGCATGTTTGGTTCGTGGAATAGAAA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">54384</td>
<td valign="top" align="left">AATTCGAAAGGACAAGGGGTTGTTCATGGATCATCAATGTATATTGGTTTTCACAAGAGAGGATAGATAGATATAGATACAGTCATGAATCTTTT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">62956</td>
<td valign="top" align="left">AATTCTGGCGATTCAGGGTGTAGACGAAGTAAGGTCTGTTGGAGAGACATAGTTTGCAGGATTTGTGATGGATTACGCTGGTGCATCAGACAGTA</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">63998</td>
<td valign="top" align="left">AATTCCCCCCGCCCCATGTTCGGGGGAGGTTTTTCAAGAGTGGGGCGTTTTCAAAATGTGTGCCCCGTGCGAAGTTCGGGTTAGACCATACCCTG</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">68215</td>
<td valign="top" align="left">AATTCCACCTCCAGACCGATTACCACTTCTTCTGTCCACGGGTAATTGATCATGTGAAGACCCATCTGACTCATCACCACGTCGGGATCGTTGGT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">11136</td>
<td valign="top" align="left">AATTCAGATGAATACAATGCAAACTAATTTGCTGTGAAAATACCGCAACAGGTAAAAGTGAGGGGATATGCAGTATCAGGAGGCGGCCGTGGTAT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">14084</td>
<td valign="top" align="left">AATTCTCTCTCTCGCTATCTCAAGATTTACACAAGTAGGAGACTCTTTGTGATCGTTGATGATGCTCCTCAGTTCTTTCGTAGTTTTGTGGCAAG</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">18527</td>
<td valign="top" align="left">AATTCTTTGCCTTGGTTGTGCTAGGAGCTAGTCCTTAGCAAGGCTAGTTCTCCAAAATCATTCTATTTGTTTGAATGAATTGCACTTGAGGTCTT</td>
</tr>
<tr>
<td valign="top" align="left" scope="row">24703</td>
<td valign="top" align="left">AATTCCCTGCCCCCCAAATGAATCATACGGATCATCACCATCAGGCCTTCCTTGGCCCCCATCTTTGTCAGATGGCATGTCACCTCCCTGTGGAT</td>
</tr>
<tr>
<td valign="top" align="left" style="border-bottom: solid 0.50pt" scope="row">42124</td>
<td valign="top" align="left" style="border-bottom: solid 0.50pt">AATTCCCTAAATTAGAGTGCATAAAAATACGATTGCGGAGCAGAAATTGGATAACGAATTGATACCTAGAAATTGACTTGCTGATGTCGGGGAAA</td>
</tr>
</tbody></table></table-wrap>

</app>
</back>
</book-part>
</book-body>
<book-back>
<notes notes-type="colophon">
<sec>
<p>For more information concerning the research in this report, contact the</p>
<p content-type="indent">Director, Western Ecological Research Center</p>
<p content-type="indent">U.S. Geological Survey</p>
<p content-type="indent">3020 State University Drive East</p>
<p content-type="indent">Sacramento, California 95819</p>
<p content-type="indent"><ext-link ext-link-type="uri" xlink:href="https://www.usgs.gov/centers/werc">https://www.usgs.gov/centers/werc</ext-link></p>
<p>Publishing support provided by the U.S. Geological Survey</p>
<p content-type="indent">Science Publishing Network, Sacramento Publishing Service Center</p>
</sec>
</notes>
</book-back>
</book>
